ENTREZ	-	Genomes
1 / 77

ENTREZ - Genomes - PowerPoint PPT Presentation

  • Uploaded on

ENTREZ - Genomes. Map Viewer I. Map Viewer II. Map Viewer IIII. Map Viewer IV. European Bioinformatics Institute (EBI). European Bioinformatics Institute (EBI). Readseq: szekvencia formátum konvertáló. nameless_1. nameless_1 Length: 457 Nov 15, 2004 10:24 Check: 7178.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about ' ENTREZ - Genomes' - aren

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript


nameless_1 Length: 457 Nov 15, 2004 10:24 Check: 7178 ..












Szekvencia formátumok I.




Szekvencia formátumok II.



Szekvencia formátumok III. – fehérjék





Elsődleges DNS vagy fehérje szekvencia összehasonlítása

más elsődleges szekvenciákhoz

abban a reményben, hogy annak a funkciója ismert

a kísérletek szükségessége

analogikus gondolkodás

ha valamilyen fehérje hasonlít valami ismert funkiójú

fehérjéhez, akkor a funkció is hasonló

kérdés: mi hordozza a funkciót?

fehérje, vagy fehérje rész,

hány funkciója van egy fehérjének?

globalitás - lokalitás

Illeszt s h tt r
Illesztés - héttér

“For many protein sequences, evolutionary history can be traced back 1-2 billion years”

-William Pearson

  • When we align sequences, we assume that they share a common ancestor

    • They are then homologous

  • Protein fold is much more conserved than protein sequence

  • DNA sequences tend to be less informative than protein sequences

Szekvenciák illesztése

  • Nagyon sok illesztés, alignment lehetséges.

  • Két szekvenciát mindig lehet illeszteni

  • Kérdés: jó-e, valós hasonlóságot mutat-e az illesztése.

  • Ehhez

  • az illesztések “jóságát” pontozni kell

  • Gyakran több illeszkedés is jó, ugyanolyan ponttal



















Szekvenciák illesztése….


Szekvencia 1

Szekvencia 2


Globális – lokális



:::::::::::: : :::::

TEGNAP VELED----------V-------OLTAM


:::::::::::: .:::::




:::::::::::: .:::::

TEGNAP VELED ----------------VOLTAM


:::::: :::: : .:::::




:::::::::::: .:::::






:::: : .:::::


Pontoz s

  • Szekvenciaszerkesztés:


    • Mutációk


    • Inszerciók


    • Deléciók



      Illeszkedés: +m

      Eltérés: -s

      Lyuk: -d

      Pont: F = (# illeszkedés)  m - (# eltérés)  s – (#lyukak)  d

DNSpontozási rendszer




Szekvencia 2


A1 0 0 0

G 0 1 0 0

C 0 0 1 0

T 0 0 0 1

Illik: 1

Nem illik: 0

pont = 5



















Szekvenciák illesztése….


Szekvencia 1

Szekvencia 2


DNSpontozási rendszer




Szekvencia 2

Negatívérték bünteti az eltéréseket:


A 5 -4 -4 -4

T -4 5 -4 -4

C -4 -4 5 -4

G -4 -4 -4 5

Illik: 5

Nem illik: 19

Score: 5 x 5 + 19 x (-4) = - 51


A 5 4 4 4 4 1 1 4 4 1 4 1 1 1 2 4

T 4 5 4 4 4 1 4 1 1 4 1 4 1 1 2 5

G 4 4 5 4 1 4 1 4 1 4 1 1 4 1 2 4

C 4 4 4 5 1 4 4 1 4 1 1 1 1 4 2 4

S 4 4 1 1 1 4 2 2 2 2 1 1 3 3 1 4

W 1 1 4 4 4 1 2 2 2 2 3 3 1 1 1 1

R 1 4 1 4 2 2 1 4 2 2 3 1 3 1 1 4

Y 4 1 4 1 2 2 4 1 2 2 1 3 1 3 1 1

K 4 1 1 4 2 2 2 2 1 4 1 3 3 1 1 1

M 1 4 4 1 2 2 2 2 4 1 3 1 1 3 1 4

B 4 1 1 1 1 3 3 1 1 3 1 2 2 2 1 1

V 1 4 1 1 1 3 1 3 3 1 2 1 2 2 1 4

H 1 1 1 4 3 1 1 3 1 3 2 2 2 1 1 1

D 1 1 1 4 3 1 1 3 1 3 2 2 2 1 1 1

N 2 2 2 2 1 1 1 1 1 1 1 1 1 1 1 2

U 4 5 4 4 4 1 4 1 1 4 1 4 1 1 2 5





































A 5 -4 -4 -4

T -4 5 -4 -4

G –4 -4 5 -4

C -4 -4 -4 5












































































































































































Illeszkedési Mátrix












A 5 -4 -4 -4

T -4 5 -4 -4

G –4 -4 5 -4

C -4 -4 -4 5

















Pont = 50



Pont = 32


Protein pontozási rendszer

  • Az aminosavaknak különböző fizikai-kémiai tulajdonságaik vannan ezek befolyásolják a kicserélhetőségüket

































Fehérjepontozási rendszer

  • Az aminosavaknak különböző fizikai-kémiai tulajdonságaik vannan ezek befolyásolják a kicserélhetőségüket

  • Pontozó mátrixnak tükröznie kell

    • a kölcsönös szubsztitúciók valószínűségét

    • az aminosavak előfordulási valószínűségét

  • Általánosan használt mátrixok:

    • PAM

    • BLOSUM

PAM (Percent Accepted Mutations) mátrixok

  • Fehérje családokból globál illesztéséből származik

  • A család tagjai legalább 85%-osan azonosak (Dayhoff et al., 1978)

  • Filogenetikus fa konstrukciója és ősi eredő szekvencia minden fehérje családra

  • aminosav cserék számítógépes analízise






PAM 250


A 2 -2 0 0 -2 0 0 1 -1 -1 -2 -1 -1 -3 1 1 1 -6 -3 0 2 1

R -2 6 0 -1 -4 1 -1 -3 2 -2 -3 3 0 -4 0 0 -1 2 -4 -2 1 2

N 0 0 2 2 -4 1 1 0 2 -2 -3 1 -2 -3 0 1 0 -4 -2 -2 4 3

D 0 -1 2 4 -5 2 3 1 1 -2 -4 0 -3 -6 -1 0 0 -7 -4 -2 5 4

C -2 -4 -4 -5 12 -5 -5 -3 -3 -2 -6 -5 -5 -4 -3 0 -2 -8 0 -2 -3 -4

Q 0 1 1 2 -5 4 2 -1 3 -2 -2 1 -1 -5 0 -1 -1 -5 -4 -2 3 5

E 0 -1 1 3 -5 2 4 0 1 -2 -3 0 -2 -5 -1 0 0 -7 -4 -2 4 5

G 1 -3 0 1 -3 -1 0 5 -2 -3 -4 -2 -3 -5 0 1 0 -7 -5 -1 2 1

H -1 2 2 1 -3 3 1 -2 6 -2 -2 0 -2 -2 0 -1 -1 -3 0 -2 3 3

I -1 -2 -2 -2 -2 -2 -2 -3 -2 5 2 -2 2 1 -2 -1 0 -5 -1 4 -1 -1

L -2 -3 -3 -4 -6 -2 -3 -4 -2 2 6 -3 4 2 -3 -3 -2 -2 -1 2 -2 -1

K -1 3 1 0 -5 1 0 -2 0 -2 -3 5 0 -5 -1 0 0 -3 -4 -2 2 2

M -1 0 -2 -3 -5 -1 -2 -3 -2 2 4 0 6 0 -2 -2 -1 -4 -2 2 -1 0

F -3 -4 -3 -6 -4 -5 -5 -5 -2 1 2 -5 0 9 -5 -3 -3 0 7 -1 -3 -4

P 1 0 0 -1 -3 0 -1 0 0 -2 -3 -1 -2 -5 6 1 0 -6 -5 -1 1 1

S 1 0 1 0 0 -1 0 1 -1 -1 -3 0 -2 -3 1 2 1 -2 -3 -1 2 1

T 1 -1 0 0 -2 -1 0 0 -1 0 -2 0 -1 -3 0 1 3 -5 -3 0 2 1

W -6 2 -4 -7 -8 -5 -7 -7 -3 -5 -2 -3 -4 0 -6 -2 -5 17 0 -6 -4 -4

Y -3 -4 -2 -4 0 -4 -4 -5 0 -1 -1 -4 -2 7 -5 -3 -3 0 10 -2 -2 -3

V 0 -2 -2 -2 -2 -2 -2 -1 -2 4 2 -2 2 -1 -1 -1 0 -6 -2 4 0 0

B 2 1 4 5 -3 3 4 2 3 -1 -2 2 -1 -3 1 2 2 -4 -2 0 6 5

Z 1 2 3 4 -4 5 5 1 3 -1 -1 2 0 -4 1 1 1 -4 -3 0 5 6

BLOSUM (Blocks Substitution Matrix)

  • Távoli rokonságban álló fehérjék doménjeinek összehasonlításából (Henikoff & Henikoff,1992).

  • Minden blokk minden oszlopjában minden aminosav előfordulását számolják

  • Az összes blokkból származtatott számokat használják aBLOSUM mátrixokhoz











A - C = 4

A - E = 2

C - E = 2

A - A = 1

C - C = 1

BLOSUM (Blocks Substitution Matrix)

  • A szekvenciákat a blokkokban csoportosítják az azonossági szintjüknek megfelelően.

  • A klasztereket egy szekvenciaként kezelik.

  • A különböző BLOSUM mátrixokkülönböznek abban, hogy hány százalékos szekvenciaazonosságot használtak a klaszterezés során.

  • A mátrix neve mögötti szám (62 BLOSUM62 esetén)a százalékos szekvencia azonosságra utal a mátrix képzése során.

  • Nagyobb számok kisebb evolúciós távolságra utalnak

BLOSUM 50 mátrix


P -2 -1 -1 -2 -1 -4 -2 -2 -1 -1

A -2 -1 5 0 5 -3 0 -2 -1 -1

W -3 -3 -3 -3 -3 15 -3 -3 -3 -3

H10 0 -2 -2 -2 -3 -2 10 0 0

E 0 6 -1 -3 -1 -3 -3 0 66

A -2 -1 5 0 5 -3 0 -2 -1 -1

E 0 6 -1 -3 -1 -3 -3 0 66

Melyik mátrixot használjuk ?

  • Általában lokális hasonlósg keresés során a BLOSUM mátrixok jobban használhatóak, mint PAMmátrixok (Henikoff & Henikoff, 1993).

  • Amikorközeli rokonságban álló fehérjéket hasonlítunk össze alacsonyabb számúPAMvagy magasabb számú BLOSUM mátrixok ajánlottak, távoli kapcsolatban álló fehérjék esetén a mátrix száma magasabb legyen PAM alacsonyabb BLOSUM mátrix esetén.

  • A BLOSUM62 az “alapmátrix” (default) adatbázis kutatás esetén









Rat versus

mouse RBP

Rat versus



Inszerciókés deléciók figyelembe vétele



A T G T - - A A T G C A


inszerció / deléció

Lyukak keletkezése negatív büntető pontokkal jár

Hézagok szankcionálása

Lyuk nem megengedett Score: 10


||| | | ||| | || || |


Match = 5

Mismatch = -4

Hézag lehet, de büntetjük Score: 88


||| || | | | ||| || | | || || |


Hézagok büntetése

  • Két szekvencia optimális alignmentjeáltalában

    • maximálja az illeszkedések

    • minimalizálja a lyukak számát.

  • Inszerciók megengedése túl sok magas pontszámú illesztéshez vezetne  fals következtetés

  • Néhány hézag viszont jót tesz az illesztésnek.

  • Hézagok büntetése matematikailag


    (g) = - gd

    Két lépcsős büntetés (Affine gap) :

    (g) = -d - (g -1)e

    (g) = ghosszúságú lyuk büntetőpontja

    d = lyuk nyitás

    e = lyuk hosszabbítás büntetétőpontja

    g = hézaghossz

    Inszerciók ésdeléciók pontozása

    passzol = 1

    nem passzol = 0

    Összpont: 4

    A T G T T A T A C

    T A T G T G C G T A T A

    Összpont:8 - 3.2 = 4.8

    A T G T - - - T A T A C

    T A T G T G C G T A T A

    Hézag paraméterek:

    d = 3 (lyuknyitás)

    e = 0.1 (lyuktágítás)

    g = 3 (lyukhossz)

    (g) = -3 - (3 -1) 0.1 = -3.2

    inszerció / deléció

    Alignment t pusok
    Alignment típusok

    • Szigorú algoritmusok - időigényes

      • Needleman-Wunsch

      • Smith-Waterman

    • Heurisztikus algoritmusok - gyors

      • BLAST

      • FASTA

    A dinamikus programozás alapelvei

    • - Alignment mátrix létrehozása

    • - Pontszámok lépésenkéntkalkulációja

    • - Visszanyomozás (backtracking)(az optimálisút megállapítása)

    Az a lignment addit v
    Az alignment additív

    Két szekvenciarészlet összevetése

    x1…xi xi+1…xM

    y1…yj yj+1…yN

    A két pontszám összeadódik:

    F(x[1:M], y[1:N]) = F(x[1:i], y[1:j]) + F(x[i+1:M], y[j+1:N])

    D i nami kus p rogram oz s i
    Dinamikusprogramozás I.

    • dinamikus programozási algoritmus

      Tegyük fel, hogy az alábbi két szekvenciát már illesztettük




      F(i,j) = az illesztés optimális értéke



    D i nami kus p rogram oz s ii
    Dinamikusprogramozás II.

    m, ha xi = yj

    F(i,j) = F(i-1, j-1) +

    s, ha nem

    Három lehetséges eset van:

    • xipasszintható yj

      x1……xi-1 xi

      y1……yj-1 yj

      2. xihézaghoz illik

      x1……xi-1 xi

      y1……yj -

    • yjhézaghoz illik

      x1……xi -

      y1……yj-1 yj

    F(i,j) = F(i-1, j) - d

    F(i,j) = F(i, j-1) - d

    D i nami kus p rogram oz s iii

    F(i-1, j-1)F(i, j-1)

    F(i-1,j)F(i, j)

    s(xi ,yj)



    Dinamikusprogramozás III.

    • Honnan tudjuk, mi a korrekt?

      Induktív feltételezés:

      F(i, j-1), F(i-1, j), F(i-1, j-1)



      F(i-1, j-1) + s(xi, yj)

      F(i, j) = max F(i-1, j) – d

      F( i, j-1) – d

      Ahol s(xi, yj) = m, ha xi = yj;

      s(xi, yj) = s, ha xi yj

    ld. mátrixok

    Needleman wunsch algoritmus
    Needleman-Wunsch Algoritmus

    • Kezdeti paraméterek.

      • F(0, 0) = 0

      • F(0, j) = - j  d

      • F(i, 0) = - i  d

    • Fő iterációk.A mátrix kitöltése

      • Minden i = 1……M

        Minden j = 1……N

        F(i-1,j-1) + s(xi, yj) [1. eset]

        F(i, j) = max F(i-1, j) – d [2. eset]

        F(i, j-1) – d [3. eset]

        átló, [1. eset]

        Ptr(i,j) = bal, [2. eset]

        fel, [3.eset]

    • Termináció. F(M, N) az optimálispont, és

      Ptr(M, N)-bőlaz optimális alignment visszanyomozható

    Azillesztési mátrix kitöltése

    H E A G A W G H E E









    -8 -16 -24 -32 -40 -48 -56 -64 -72 -80








    Perem feltételek

    F(i, 0) = -id

    F(j, 0) = -jd

    F(i, j) = F(i-1, j-1) + s(xi ,yj)

    F(i, j) = max F(i, j) = F(i-1, j) - d

    F(i, j) = F(i, j-1) - d

    F(0,0) + s(xi ,yj) = 0 -2 = -2

    F(1,1) = max F(0,1) - d = -8 -8= -16 = -2

    F(1,0) - d = -8 -8= -16

    F(1,0) + s(xi ,yj) = -8 -1 = -9

    F(2,1) = max F(1,1) - d = -2 -8 = -10 = -9

    F(2,0) - d = -16 -8= -24

    -2 -1 = -3

    F(2,2) = max -10 -8 = -18 = -3

    -9 -8 = -17

    -8 -2 = -10

    F(1,2) = max -16 -8 = -24 = -10

    -2 -8 = -10

    Azillesztési mátrix kitöltése

    H E A G A W G H E E

    0 -8 -16 -24 -32 -40 -48 -56 -64 -72 -80

    P -8

    A -16

    W -24

    H -32

    E -40

    A -48

    E -56












    H E A G A W G H E E

    0 -8 -16 -24 -32 -40 -48 -56 -64 -72 -80

    P -8 -2 -9 -17 -25 -33 -42 -49 -57 -65 -73

    A -16 -10 -3 -4 -12 -20 -28 -36 -44 -52 -60

    W -24 -18 -11 -6 -7 -15 -5 -13 -21 -29 -37

    H -32 -14 -18 -13 -8 -9 -13 -7 -3 -11 -19

    E -40 -22 -8 -16 -16 -9 -12 -15 -7 3 -5

    A -48 -30 -16 -3 -11 -11 -12 -12 -15 -5 2

    E -56 -38 -24 -11 -6 -12 -14 -15 -12 -9 1

































    Optimális globál alignment:

    Smith - Waterman(lokális alignment)

    Két különbség:


    2. Az alignment bárhol befejeződhet a mátrixban


    F(i, j) = F(i-1, j-1) + s(xi ,yj)

    F(i, j) = F(i-1, j) - d

    F(i, j) = F(i, j-1) - d

    F(i, j) = max


    Szekvencia1 H E A G A W G H E E

    Szekvencia2 P A W H E A E

    Mátrix: BLOSUMLyukbüntetés: Lineáris, d=8



    Smith - Waterman alignment

    H E A G A W G H E E

    0 0 0 0 0 0 0 0 0 0 0

    P 0 0 0 0 0 0 0 0 0 0 0

    A 0 0 0 5 0 5 0 0 0 0 0

    W 0 0 0 0 2 0 20 12 4 0 0

    H 0 10 2 0 0 0 12 18 22 14 6

    E 0 2 16 8 0 0 4 10 18 28 20

    A 0 0 8 21 13 5 0 4 10 20 27

    E 0 0 6 13 18 12 4 0 4 16 26











    Optimal local alignment:

    Extended Smith & Waterman

    • Több lokális alignment kapható:

    • a legjobb útvonal körüli régió törlése

    • ismételt visszanyomozás (backtracking)

    Extended Smith & Waterman



    20 12 4

    12 18 22 14 6

    4 10 18 28 20

    4 10 20 27

    4 16 26

    H E A G A W G H E E

    0 0 0 0 0 0 0 0 0 0 0

    P 0 0 0 0 0 0 0 0 0

    A 0 0 0 5 0 0 0 0 0 0

    W 0 0 0 0 2 0 0 0

    H 0 10 2 0 0 0

    E 0 2 16 8 0 0

    A 0 0 8 21 13 5 0

    E 0 0 6 13 18 12 4 0

    Extended Smith & Waterman



    H E A G A W G H E E

    0 0 0 0 0 0 0 0 0 0 0

    P 0 0 0 0 0 0 0 0 0 0

    A 0 0 0 5 0 0 0 0 0 0

    W 0 0 0 0 2 0 0 0

    H 0 10 2 0 0 0

    E 0 2 16 8 0 0

    A 0 0 8 21 13 5 0

    E 0 0 6 13 18 12 4 0








    Másodiklegjobblokális alignment:



    Heuristic methods
    Heuristic Methods

    • FastA (Pearson and Lipman)

    • Blast / Blast2 (Altschul)

    Fasta pearson and lipman
    FastA (Pearson and Lipman)

    • 1.Rövid, rögzített hosszúságú azonos betűsor keresése

    • 2.Minden átló pontszámát meghatározzuk.

    • 3.A 10 legmagasabbpontszámú átlós régiót újrapontozzuk

    • a pontszám táblázatok alapján (kezdeti régiók).

    • A legmagasabb pontszám (score) init1.

    • 4.Szomszédos kezdeti átlók összekötése.

    • A legmagasabb pontszám (score) initn.

    • 5. Azokra a szekvenciákra, ahol az initn pontszám meghalad egy

    • küszöbértéket (treshold)opt-score, z-score, és E() értéket

    • számolunk.

    • Azokat a szekvenciákat listázzuk, amiknek az E() értéke

    • kisebb, mint egy adott küszöbérték

    R gz tett hossz s g azonos szavak keres se


    1 lépés


    Rögzített hosszúságú azonos szavak keresése



    Szó hossz:DNS: 6

    Protein: 2

    kereső szekvencia

    Fasta pearson and lipman1
    FastA (Pearson and Lipman)

    • 1.Rövid, rögzített hosszúságú azonos betűsor keresése

    • 2.Minden átló pontszámát meghatározzuk.

    • 3.A 10 legmagasabbpontszámú átlós régiót újrapontozzuk

    • a pontszám táblázatok alapján (kezdeti régiók).

    • A legmagasabb pontszám (score) init1.

    • 4.Szomszédos kezdeti átlók összekötése.

    • A legmagasabb pontszám (score) initn.

    • 5. Azokra a szekvenciákra, ahol az initn pontszám meghalad egy

    • küszöbértéket (treshold)opt-score, z-score, és E() értéket

    • számolunk.

    • Azokat a szekvenciákat listázzuk, amiknek az E() értéke

    • kisebb, mint egy adott küszöbérték

    Tl k pontoz sa


    2. lépés


    Átlók pontozása



    DNS:Passzol: 5

    Eltérés: - 4


    Pontszám mátrixok

    kereső szekvencia

    Pontszám = 60

    Fasta pearson and lipman2
    FastA (Pearson and Lipman)

    • 1.Rövid, rögzített hosszúságú azonos betűsor keresése

    • 2.Minden átló pontszámát meghatározzuk.

    • 3.A 10 legmagasabbpontszámú átlós régiót újrapontozzuk

    • a pontszám táblázatok alapján (kezdeti régiók).

    • A legmagasabb pontszám (score) init1.

    • 4.Szomszédos kezdeti átlók összekötése.

    • A legmagasabb pontszám (score) initn.

    • 5. Azokra a szekvenciákra, ahol az initn pontszám meghalad egy

    • küszöbértéket (treshold)opt-score, z-score, és E() értéket

    • számolunk.

    • Azokat a szekvenciákat listázzuk, amiknek az E() értéke

    • kisebb, mint egy adott küszöbérték

    Az tl k pontoz sa


    3. lépés


    Az átlók pontozása




    Eltérés: - 4


    Pontszám mátrixok

    kereső szekvencia

    Pontszám > 60 (INIT1)

    Fasta pearson and lipman3
    FastA (Pearson and Lipman)

    • 1.Rövid, rögzített hosszúságú azonos betűsor keresése

    • 2.Minden átló pontszámát meghatározzuk.

    • 3.A 10 legmagasabbpontszámú átlós régiót újrapontozzuk

    • a pontszám táblázatok alapján (kezdeti régiók).

    • A legmagasabb pontszám (score) init1.

    • 4.Szomszédos kezdeti átlók összekötése.

    • A legmagasabb pontszám (score) initn.

    • 5. Azokra a szekvenciákra, ahol az initn pontszám meghalad egy

    • küszöbértéket (treshold)opt-score, z-score, és E() értéket

    • számolunk.

    • Azokat a szekvenciákat listázzuk, amiknek az E() értéke

    • kisebb, mint egy adott küszöbérték

    A szomsz dok tl s szakaszok sszek t se


    4. lépés


    A szomszédok átlós szakaszok összekötése



    kereső szekvencia

    INITN = pont + pont - “kapcsolási büntetés”



    Fasta pearson and lipman4
    FastA(Pearson and Lipman)

    • 1.Rövid, rögzített hosszúságú azonos betűsor keresése

    • 2.Minden átló pontszámát meghatározzuk.

    • 3.A 10 legmagasabbpontszámú átlós régiót újrapontozzuk

    • a pontszám táblázatok alapján (kezdeti régiók).

    • A legmagasabb pontszám (score) init1.

    • 4.Szomszédos kezdeti átlók összekötése.

    • A legmagasabb pontszám (score) initn.

    • 5. Azokra a szekvenciákra, ahol az initn pontszám meghalad egy

    • küszöbértéket (treshold)opt-score, z-score, és E() értéket

    • számolunk.

    • Azokat a szekvenciákat listázzuk, amiknek az E() értéke

    • kisebb, mint egy adott küszöbérték

    Pontsz m kalkul ci

    5. lépés


    Pontszám kalkuláció

    Opt-score: Smith-Waterman pontszám

    Z-score: normalizált az adatbázis szekvencia hosszára

    E() value A pontszám várható értéke

    Mi az oka a jó pontszámnak? A sorrend vagy az összetétel?

    Z= (Sc – MSc) / σ

    Mi az oka a jó pontszámnak? A homológia vagy a nagy adatbázis?

    E: annak a valószínűsége, hogy az adott (homológiájú) szekvencia véletlen szerűen szerepel az adatbázisban;Az ilyen homológiát mutató szekvenciák várható száma

    Fasta pearson and lipman5
    FastA(Pearson and Lipman)

    • 1.Rövid, rögzített hosszúságú azonos betűsor keresése

    • 2.Minden átló pontszámát meghatározzuk.

    • 3.A 10 legmagasabbpontszámú átlós régiót újrapontozzuk

    • a pontszám táblázatok alapján (kezdeti régiók).

    • A legmagasabb pontszám (score) init1.

    • 4.Szomszédos kezdeti átlók összekötése.

    • A legmagasabb pontszám (score) initn.

    • 5. Azokra a szekvenciákra, ahol az initn pontszám meghalad egy

    • küszöbértéket (treshold)opt-score, z-score, és E() értéket

    • számolunk.

    • Azokat a szekvenciákat listázzuk, amiknek az E() értéke

    • kisebb, mint egy adott küszöbérték

    Fasta eredm ny




    FastA eredmény:

    Results sorted and z-values calculated from opt score

    1770 scores saved that exceeded 107

    4614416 optimizations performed

    Joining threshold: 47, optimization threshold: 32, opt. width: 16

    The best scores are: init1 initnopt z-sc E(5219455)

    EMORG:CHPHET01 Begin: 1 End:162

    ! M37322 P.hybrida chloroplast rpS19 810 810 810 614.0 5e-25

    EMORG:CHPHETIR Begin:31 End:183 Strand: -

    ! M35955 P.hybrida chloroplast rps19' 410 410 699 531.8 1.7e-20

    EMORG:SNCPJLB Begin: 2 End:150

    ! Z71250 S.nigrum chloroplast JLB reg 457 457 659 499.2 6.8e-19

    EMORG:NPCPJLB Begin: 2 End:151

    ! Z71235 N.palmeri chloroplast JLB re 642 642 659 501.5 7e-19

    EMORG:NBCPJLB Begin: 2 End:158

    ! Z71226 N.bigelovii chloroplast JLB 472 472 644 485.5 2.7e-18

    EMORG:STCPJLB Begin: 2 End:149

    ! Z71248 S.tuberosum chloroplast JLB 452 452 641 485.4 3.7e-17

    F ast a program ok
    FASTA programok:

    hasonlóság keresés kereső szekvenciaés bármilyen típusú szekvencia között(DNSés Protein).

    peptid szekvenciákat nukleotid szekvenciákkal szemben.

    nukleotidek szekvenciákatfehérje adatbázissal szemben“frameshift“-eket figyelembe véve.

    nukleotid szekvenciákat nukleotid szekvenciaadatbázissalfehérje szinten.






    (Basic Local Alignment Search Tool)


    • A kereső szekvencia összes lehetséges szavából létrehoz egy szótárat

    • Lokális alignmentet indít minden szóraami talál párt az adatbázisban

      Futási idő: O(MN)

      Nagyságrendekkel gyorsabb, mint a Smith-Waterman



    Blast eredeti ver zi
    BLAST Eredeti Verzió




    Minden k hosszú szó (~11)

    Alignment aszavak között, ezek pontja legyen  T

    (tipikusan T = k)


    Ungapped extenziókamíga pontszám a statisztikaiküszöb (threshold) alatt


    Minden olyan alignment, melynek pontszáma > statisztikai küszöb(threshold)





    Blast eredeti verzi
    BLAST Eredeti verzió


    k = 4,

    T = 4

    Az illesztett szó GGTC iniciál egy alignmentet

    Hézagmentes extenzióbalra és jobbra gaps,amíg az alignment < 50%




    A C G A A G T A A G G T C C A G T

    C C C T T C C T G G A T T G C G A

    Gapped blast
    Gapped BLAST

    A C G A A G T A A G G T C C A G T

    Plussz tulajdonságok:

    • szó párokkal lehet


    • Extenziók lyukakkal a váz körüli sávon belül




    C T G A T C C T G G A T T G C G A

    Gapped blast1
    Gapped BLAST

    A C G A A G T A A G G T C C A G T

    Plussz tulajdonságok:

    • szó párokkal lehet


    • Közeli alignmentekösszeolvasztva

    • Extenziókhézagokkal amíg a pontszám < T az addigi legjobb pontszám alá kerül




    C T G A T C C T G G A T T G C G A

    Blast vari ci k
    BLAST variációk


      • Nagyon hasonló szekvenciák összahasonlítására van optimalizálva

        • Legjobban működik, ha k = 4i  16

        • Lineárislyuk szankció

    • PSI-BLAST:

      • BLAST-tal sok találat

      • ezeket illesztjük, és mintázatot (pattern)kreálunk

      • ezt a mintázatot használjuk a következő kereséshez

        ezeket a lépéseket iteratíve ismételjük

    • WU-BLAST: (Wash U BLAST)

      • Optimilizált, extra tulajdonságok

    • BlastZ

      • BLAST/PatternHunter metódus kombinációja

    BLAST programok

    ProgramInput Adatbázis











    P lda

    Query:gattacaccccgattacaccccgattaca (29 letters) [2 mins]

    Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) 1,726,556 sequences; 8,074,398,388 total letters

    >gi|28570323|gb|AC108906.9|Oryza sativa chromosome 3 BAC OSJNBa0087C10 genomic sequence, complete sequence Length = 144487 Score = 34.2 bits (17), Expect = 4.5 Identities = 20/21 (95%) Strand = Plus / Plus

    Query: 4 tacaccccgattacaccccga 24

    ||||||| |||||||||||||

    Sbjct: 125138 tacacccagattacaccccga 125158

    Score = 34.2 bits (17),

    Expect = 4.5 Identities = 20/21 (95%) Strand = Plus / Plus

    Query: 4 tacaccccgattacaccccga 24

    ||||||| |||||||||||||

    Sbjct: 125104 tacacccagattacaccccga 125124

    >gi|28173089|gb|AC104321.7| Oryza sativa chromosome 3 BAC OSJNBa0052F07 genomic sequence, complete sequence Length = 139823 Score = 34.2 bits (17), Expect = 4.5 Identities = 20/21 (95%) Strand = Plus / Plus

    Query: 4 tacaccccgattacaccccga 24

    ||||||| |||||||||||||

    Sbjct: 3891 tacacccagattacaccccga 3911

    P lda1

    Query: Human atoh enhancer, 179 letters [1.5 min]

    Result: 57 blast hits

    • gi|7677270|gb|AF218259.1|AF218259 Homo sapiens ATOH1 enhanc... 355 1e-95

    • gi|22779500|gb|AC091158.11| Mus musculus Strain C57BL6/J ch... 264 4e-68

    • gi|7677269|gb|AF218258.1|AF218258 Mus musculus Atoh1 enhanc... 256 9e-66

    • gi|28875397|gb|AF467292.1| Gallus gallus CATH1 (CATH1) gene... 78 5e-12

    • gi|27550980|emb|AL807792.6| Zebrafish DNA sequence from clo... 54 7e-05

    • gi|22002129|gb|AC092389.4| Oryza sativa chromosome 10 BAC O... 44 0.068

    • gi|22094122|ref|NM_013676.1| Mus musculus suppressor of Ty ... 42 0.27

    • gi|13938031|gb|BC007132.1| Mus musculus, Similar to suppres... 42 0.27

      gi|7677269|gb|AF218258.1|AF218258 Mus musculus Atoh1 enhancer sequence Length = 1517

      Score = 256 bits (129), Expect = 9e-66 Identities = 167/177 (94%),

      Gaps = 2/177 (1%) Strand = Plus / Plus

      Query: 3 tgacaatagagggtctggcagaggctcctggccgcggtgcggagcgtctggagcggagca 62

      ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||

      Sbjct: 1144 tgacaatagaggggctggcagaggctcctggccccggtgcggagcgtctggagcggagca 1203

      Query: 63 cgcgctgtcagctggtgagcgcactctcctttcaggcagctccccggggagctgtgcggc 122

      |||||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||

      Sbjct: 1204 cgcgctgtcagctggtgagcgcactc-gctttcaggccgctccccggggagctgagcggc 1262

      Query: 123 cacatttaacaccatcatcacccctccccggcctcctcaacctcggcctcctcctcg 179

      ||||||||||||| || ||| |||||||||||||||||||| |||||||||||||||

      Sbjct: 1263 cacatttaacaccgtcgtca-ccctccccggcctcctcaacatcggcctcctcctcg 1318
