Genetics Unit – Lesson
Download
1 / 18

Genetics Unit – Lesson 8: Genetic Disorders & Mutation - PowerPoint PPT Presentation


  • 132 Views
  • Uploaded on

Genetics Unit – Lesson 8: Genetic Disorders & Mutation. Course: Monarch Park Grade IB Biology (SBI-4IB) Teacher: Ms. Founk Email: [email protected] Human maladies. Measles. Cholera. Chicken pox. Melanoma. Alzheimers. Stroke. Tuberculosis. STDs. Heart disease.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Genetics Unit – Lesson 8: Genetic Disorders & Mutation' - anitra


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Genetics Unit – Lesson 8: Genetic Disorders & Mutation

Course: Monarch Park

Grade IB Biology (SBI-4IB)

Teacher: Ms. Founk

Email: [email protected]


Human maladies

Measles

Cholera

Chicken pox

Melanoma

Alzheimers

Stroke

Tuberculosis

STDs

Heart disease

Huntington’s disease

Sickle cell anemia

Autism

Cold/Flu

Parkinson’s disease

Crohn’s

Scurvy

Malaria

HIV/AIDS

Lung cancer

Lou Gehrig’s Disease/ALS

Kidney stones

Down syndrome

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Do you make more errors than a cell?

Errors during meiosis: Non-disjunction

Meiosis is a process that uses cellular division to produce the sex cells or gametes that are used for reproduction. During meiosis, the cell identifies chromosome pairs and sorts them to opposite sides of the cell. Sometimes, errors occur during this sorting process resulting in extra or missing chromosomes.

  • INSTRUCTIONS

  • Cut out chromosomes pairs

  • Mix the shapes in a pile on your desk. Imagine that this represents the nucleus of a cell

  • When instructed, sort the 23 chromosome pairs as fast as you can so that 1 copy of each chromosome is on either side of your desk.

  • You will have 1 minute to sort.

  • After 1 min, record the number of pairs you were able to successfully sort

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Detecting chromosome abnormalities

Karyotyping

Chromosomes are sorted according to several characteristics:

  • Chromosome length

  • Chromosome structure

    • Banding pattern

    • Position of centromere

Karyotypes are used to assess the sex of a person

  • The X chromosome is much larger than the Y chromosome

  • XX = female

  • XY = male

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Detecting chromosome abnormalities

Karyotyping

Varying numbers of sex chromosomes lead to a variety of different disorders

TRIPLE X (XXX = female)

TURNER SYNDROME (XO = female)

Watch this talk:

http://www.ted.com/talks/lang/en/alice_dreger_is_anatomy_destiny.html

KLINEFELTER SYNDROME (XXY = male)

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Detecting chromosome abnormalities

Karyotyping

Varying numbers of autosomeslead to a variety of different disorders

Look up

Look up

DOWN SYNDROME (Trisomy 21)

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Do you make more errors than a cell?

Errors during DNA replication: Point mutations

DNA replication occurs before mitosis and meiosis so that a new copy of DNA is created. The cell is very good at copying the 3 billion base pairs of DNA present in every human cell, but sometimes it makes mistakes.

Sequence: ATCCGACGTTTGCGATCGATCGATGGGGTCGATAAAAGCT

Copy of Sequence: ____________________________________________

Number of mistakes: _______________________

Complementary Sequence: ____________________________________________

Number of mistakes: _______________________

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Point mutations are single nucleotide changes in the DNA

Point mutations can have varying effects within the cell

e.g. Transcribe and translate the following sense strand: TTA TAT CTC GTA

UUA UAU CUC GUA

Leu Met Leu Val

TTA TAA CTC GTA

TTA TTA TCT CGT A

TTA TAT ATC GTA

TTA TAT CTT GTA

UUA UUA UCU CGU A

UUA UAA CUC GUA

UUA UAU CUU GUA

UUA UAU AUC GUA

LeuLeu Ser Ala

LeuStop

Leu Met LeuVal

Leu Met Ile Val

Missense mutation

Silent mutation

Nonsense mutation

Frameshift mutation

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


A Case Study: Sickle Cell Anemia

Transcribe and translate a section of the genome that encodes for hemoglobin (Hb)

sense

sense

CCU GUG GAG

CCU GAG GAG

Pro Val Glu

Pro GluGlu

Glutamic acid

Valine

Sickle cell anemia

Normal blood cell

Changing a single nucleotide changes the mRNA sequence which changes the codonwhich changes the amino acid. Glutamic acid and valine have very different chemical and physical properties which affects the ability of the hemoglobin to form proper quaternary structure resulting in sickle looking cells that have decreased ability to carry oxygen in the blood.

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Repair pathways within the cell

SIDE NOTE: The cell has proteins that work to repair DNA

  • BRCA1 – gene linked to breast cancer

  • Repairs cell from double strand breaks

  • Repair proteins can be identified using DNA damage foci

  • BLAST tool from NCBI can be used to align sequences and detect sequence differences

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Genetics Unit – Lesson 8: Genetic Disorders & Mutation

Course: Monarch Park

Grade IB Biology (SBI-4IB)

Teacher: Ms. Founk

Email: [email protected]


Do you make more errors than a cell?

Errors during meiosis: Non-disjunction

Meiosis is a process that uses cellular division to produce the sex cells or gametes that are used for reproduction. During meiosis, the cell identifies chromosome pairs and sorts them to opposite sides of the cell. Sometimes, errors occur during this sorting process resulting in extra or missing chromosomes.

  • INSTRUCTIONS

  • Cut out chromosomes pairs

  • Mix the shapes in a pile on your desk. Imagine that this represents the nucleus of a cell

  • When instructed, sort the 23 chromosome pairs as fast as you can so that 1 copy of each chromosome is on either side of your desk.

  • You will have 1 minute to sort.

  • After 1 min, record the number of pairs you were able to successfully sort

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Detecting chromosome abnormalities

Karyotyping

Chromosomes are sorted according to several characteristics:

  • Chromosome _________

  • Chromosome _________

    • ________________

    • ________________

Karyotypes are used to assess the sex of a person

  • The X chromosome is much _______than the Y chromosome

  • XX = ____________

  • XY = ____________

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Detecting chromosome abnormalities

Karyotyping

Varying numbers of ________________ lead to a variety of different disorders

Watch this talk:

http://www.ted.com/talks/lang/en/alice_dreger_is_anatomy_destiny.html

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Detecting chromosome abnormalities

Karyotyping

Varying numbers of _____________ lead to a variety of different disorders

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Do you make more errors than a cell?

Errors during DNA replication: Point mutations

DNA replication occurs before mitosis and meiosis so that a new copy of DNA is created. The cell is very good at copying the 3 billion base pairs of DNA present in every human cell, but sometimes it makes mistakes.

Sequence: ATCCGACGTTTGCGATCGATCGATGGGGTCGATAAAAGCT

Copy of Sequence: ____________________________________________

Number of mistakes: _______________________

Complementary Sequence: ____________________________________________

Number of mistakes: _______________________

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


Point mutations are single nucleotide changes in the DNA

Point mutations can have varying effects within the cell

e.g. Transcribe and translate the following sense strand: TTA TAT CTC GTA

UUA UAU CUC GUA

Leu Met Leu Val

TTA TAA CTC GTA

TTA TTA TCT CGT A

TTA TAT ATC GTA

TTA TAT CTT GTA

UUA UUA UCU CGU A

UUA UAA CUC GUA

UUA UAU CUU GUA

UUA UAU AUC GUA

LeuLeu Ser Ala

LeuStop

Leu Met LeuVal

Leu Met Ile Val

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


A Case Study: Sickle Cell Anemia

Transcribe and translate a section of the genome that encodes for _______________

sense

sense

Glutamic acid

Valine

______________

______________

Changing a single nucleotide changes the mRNA sequence which changes the codonwhich changes the amino acid. Glutamic acid and valine have very different chemical and physical properties which affects the ability of the hemoglobin to form proper quaternary structure resulting in sickle looking cells that have decreased ability to carry oxygen in the blood.

Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants


ad