Department of biology post graduate school bogor agricultural university 2009
This presentation is the property of its rightful owner.
Sponsored Links
1 / 25

MAJOR MICROBIOLOGY PowerPoint PPT Presentation


  • 101 Views
  • Uploaded on
  • Presentation posted in: General

DEPARTMENT OF BIOLOGY POST GRADUATE SCHOOL BOGOR AGRICULTURAL UNIVERSITY 2009. MAJOR MICROBIOLOGY. MAJOR MICROBIOLOGY : AN OVERVIEW. Established in 1990 as Subprogram Study in the Study Program of Biology Composed on 2 division: Microbiology (Bacteriology) Mycology

Download Presentation

MAJOR MICROBIOLOGY

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Department of biology post graduate school bogor agricultural university 2009

DEPARTMENT OF BIOLOGY

POST GRADUATE SCHOOL

BOGOR AGRICULTURAL UNIVERSITY

2009

MAJOR MICROBIOLOGY


Major microbiology

MAJOR MICROBIOLOGY : AN OVERVIEW

  • Established in 1990 as Subprogram Study in the Study Program of Biology

  • Composed on 2 division: Microbiology (Bacteriology)

  • Mycology

  • Staffs: 1 Prof, 10 doctors

    • Number of Student : ongoing student: 13 master, 8 doctoral

      • incoming student: 16 master, 3 doctoral

  • Programmes :

  • 1. Master in Microbiology: microbial biodiversity and bioprospecting, and environmental microbiology

    • Doctor of Philosophy in Microbiology

    • Supporting unit: IPB Culture Collection (currently developing through I-MHERE project


  • Major microbiology

    VISION

    • To be recognized world-wide as the leading centre in tropical microbiological science for agriculture development and for human life quality improvement in 2020.


    Mission

    MISSION

    • To develop human resources with high capacities in tropical microbial knowledge and technologies through undergraduate and postgraduate education.

    • To expand and transfer microbial knowledge and technologies for continuous improvement of agriculture and human life.

    • Increase the quality and quantity of research in tropical microbial knowledge and technologies particularly in biodiversity and bio-prospecting.

    • Increase networking through research and education partnership locally, nationally and globally.


    Curriculum master of science program 39 csu

    CURRICULUMMaster of Science Program (39 CSU)

    General courses

    English 3 CSU

    Stastical Analyses 3 CSU

    Compulsory courses

    Advanced Microbiology 2 CSU

    Microbial Physiology 2 CSU

    Microbial Genetic 2 CSU

    Microbial Laboratory 2 CSU

    Microbial Biotechnology 3 CSU

    Fungal Biotechnology 3 CSU

    Methodology of Science 2 CSU

    Colloqium 1 CSU

    Seminar 1 CSU

    Research and Thesis 6 CSU

    Elective courses

    Bio- prosepecting

    Industrial Microbiology 3 CSU

    Molecular Biotechnology 3 CSU

    Biotechnology of Antimicrobial Susbtance 3 CSU

    Environmental Microbiology

    Host-Microbes Interaction 3 CSU

    Environmental Microbiology 3 CSU

    Spoilage Fungi and Mycotoxins in foodstuff 3 CSU


    Curriculum doctor of philospophy program 41 csu

    CURRICULUMDoctor of Philospophy Program (41 CSU)

    General Course

    Philosophy of Science 2 CSU

    Compulsory courses

    Advanced Microbial Physiology 3 CSU

    Advanced Fungal Biology 3 CSU

    Molecular Biology of Prokaryotic

    Diversity 3 CSU

    Microbial Genetic Engineering 3 CSU

    Colloqium 1 CSU

    Seminar 1 CSU

    Research and Thesis 12 CSU

    Elective courses

    Biology of Pathogenic Bacteria2 CSU

    Gene Expression and Regulation 3 CSU

    Biology and Productivity of

    Actinomycetes 3 CSU

    Biology of Mycorrhiza3 CSU

    Biology and Productivity of

    Macrofungi3 CSU


    Teaching staffs and field interest

    Teaching Staffs and Field Interest

    • Prof. Dr. Antonius Suwanto, MSc., Ph.D (Microbiology and Molecular genetics)

    • Dr. Anja Meryandini, MS (Microbial Physiology and Enzymology)

    • Dr. Aris Tri Wahyudi, MSi (Microbial Biotechnology)

    • Dr. Iman Rusmana, MSi. (Environmental Microbiology)

    • Dr. Nisa Rachmania, MSi. (Microbiology and Microbial Physiology)

    • Dr. dr. Sri Budiarti (Medical Microbiology, Bacterial-Human Cell Interaction)

    • Dr. Yulin Lestari (Microbial Ecophysiology)

    • Dr. Gayuh Rahayu (Mycology and Phytopathology)

    • Dr. Lisdar A Manaf (Mushroom Biology and Fungal Ecophysiology)

    • Dr. Nampiah Sukarno (Mycology and Mycorrhizal Biology)

    • Dr. Okky S. Darmaputra (Post Harvest Mycology)


    Major microbiology

    RESEARCH


    Major microbiology

    BACTERIOLOGY


    Major microbiology

    Aris Tri Wahyudi, PhD

    Marine Bioechnology

    Student Involved: 4 Students

    Sponge-Associated

    Bacteria

    Molecular

    Genetics

    Producing Anti-

    microbial Compounds

    Producing

    Enzyme Inhibitors

    Targets: 1. Antimicrobial Compounds from sponge-associated Bacteria

    2. Molecules/Compounds as Enzyme Inhibitors

    3. Molecular Genetic of Antimicrobial Compounds Synthesis


    Major microbiology

    Aris Tri Wahyudi, PhD

    Aris Tri Wahyudi, PhD

    -Pseudomonas sp

    -Bacillus sp

    Plant Growth PromotingRhizobacteria (PGPR)

    Student involved: 7 Students

    (2 PhD ; 2 S-2, 3 S-1)

    Formulation and

    Inoculant Prod.

    Biocontrol of

    Phytopathogen

    Plant Growth

    Promotion

    Bioactive Compounds

    Anti Phytopathogen

    • Formulation of PGPR as plant growth and Biocontrol

    • Molecular Genetic of Bioactive Compound Synthesis

    • Bioactive Compounds/Antibiotic from PGPR


    Major microbiology

    Dr. AnjaMeryandini

    • Research Interest: Microbial enzymes

    • Bacterial protease

    • Bacterial mannanase

    • Bacterial xylanase

    for animal feed processing

    451-3

    234P-16

    SKK1-8

    Clostridium bifermentansproducing protease enzyme

    Streptomycessp. producing xylanase enzyme


    Major microbiology

    0.5 mm

    0.5 mm

    0.5 mm

    0.5 mm

    0.5 mm

    0.5 mm

    0.5 mm

    Dr. Nisa Rachmania Mubarik, MSi

    Head of Microbiology Division, Department of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University

    • Research Interest:

    • Symbiotic Effectiveness of Inoculant Acid-Alumunium Tolerant Bradyrhizobium japonicum Strains with Soybean Cultivar Slamet in Acid Soils (3 master students, 2007-2009)

    • Isolations,Characterizations and Applications Microbial Enzymes (Protease, Amylase, Chitinase) (7 undergraduate student, 1 master students, 2007-2009)

    Chitin hydrolizationat 12 hours by cell cultures and chitinase of bacterial isolates I.5 and I.21 tested to Bemisiatabaci. Control (a), cell cultures treatment (b-d), enzyme treatment (e-g).

    Inoculant B. japonicum on peat carrier.


    Major microbiology

    Dr. ImanRusmana([email protected])

    Environmental Microbiologist

    RESEARCH INTEREST:

    Nitrogen cycling and N2O emission in tropical estuaries and agricultural system

    Student involved (9 master, 1 PhD)

    • Current Research Topics:

    • Methanotrophicbacteria as biofertilizersand methane emission reducers in rice fields

    • N2O reducing bacteria to reduce N2O emission from agriculture system

    • Nitrate reducing bacteria and Bacillus spp. as bioactive of biofilter in close system of larval rearing and nursery of aquacultures

    • Nitrate reducing and nitrifying bacteria as bioconditioner controlling nitrite and ammonia in shrimp ponds


    Major microbiology

    FROM MOLECULAR TO ECOLOGY

    Sampling for measurement and molecular analysis of nitrate reducing bacteria in sediment of tropical estuaries

    Bacteriocins purification and its antimicrobial activity from Bacillus spp. isolated from shrimp ponds

    Molecular characterization of methane monooxygenase genes

    Forward sequence of BGM9 mmoX gene:

    ATAANCGCAGCGTGTTNCAGGTCCGCGAGATCGCCGACCAGTCCGCCGCCGNCAGCNAGCAGACCGCCAGCTCCAGCAACGAACTGGCGCACCTGGGCAACGAGCTGCAACTGCAGGTGGGACGTTTCCGCCTGTGACACGCCNGTCGGTCGGTACGCCCGCTCCGGCCGATAACGGCAGGACAGTTGTCATGCGCATGGCGTAGGATCGGACACTCGCCATGAAGGGAGAGTGACCATGCGCCCGCTGACCATCGATATCGACGAACTGGACCTTCGCGCTTGATACCCAGGGTATCGATCACTACCTCGACCTGTTCAGTGGCCAGGTGCTGCTGATACCGGAGGACGACCCCGACCCGGAGCTCGCCGAACTGCTGCACCGCGAGCCGGAGCGCTACGAGTG

    Size of DNA fragments

    Reverse sequence of BGM9 mmoX gene:

    GGTATCANCAGCACCATGGCCACTGAACAGGTCGAGGTAGTGATCGATACCCTGGGTATCAAGCGCGAAGGCCAGTTCGTCGATATCGATGGTCAGCGGGCGCATGGTCACTCTCCCTTCATGGCGAGTGTCCGATCCTACGCCATGCGCATGACAACTGTCCTGCCGTTATCGGCCGGAGCGGGCGTACCGACCGACAGGCGCGTCACAGGCGGAAACGTCCCACCTGCAGTTGCAGCTCGTTGCCCAGGCGCGCCAGTTCGGTGCTGGAGCTGGCGGTCTGCTCGCTGGCGGCGGCGGACTGGTCGGCGATCTCGCGGACCTGCACCACGCTGCGGTTGATCTCCTCGGCAACGCTGCTCTGCTCCTCGGCGGCCGANGCGATCTGCAGGTTCATGCCCTTCCACAGCGGATATAATA

    Amplification

    of mmoX gene

    Amplification

    of pmoA gene


    Major microbiology

    Dr. dr. Sri Budiarti

    • Research Interest: Medicinal Microbiology

    • EnteropathogenicEschericia coli:

    • - mode of infection

    • - Extracellular protease activity

    • - Monoclonal antibody antiprotease activity

    • -Diagnostic kit design

    • Dengue and environmental health

    • Screening of Antimicrobial substance from bacteria and fungi


    Major microbiology

    Dr.Ir. Yulin Lestari

    INDONESIAN ACTINOMYCETES AS SOURCE OF BIOACTIVE COMPOUNDS USED FOR SOLVING AGRICULTURE, ENVIRONMENT AND HEALTH PROBLEMS

    • Collection of Actinomycetes isolates from unique tropical environment, and endophyteactinomycetes

    • In vitro and in vivo assay for: antimicrobes, enzyme inhibitor (e.g. a-glucosidase, b-lactamase), degrading enzymes (lipase, cellulose and lignolitic enzymes)

    • Target organisms: agriculture & horticulture plants, plantation, poultry, and human )

    • Student involve: undergraduates (2) ,graduates ( 4 Master students), and 3 PhD students)


    Major microbiology

    MYCOLOGY


    Major microbiology

    Diversity of Indonesian Filamentous Fungi (205 genera)

    Ascomycota

    Incertae

    sedis

    Eurotiales

    Hypocreales

    Basidiomycota

    Zygomycota

    Agaricales

    Mucorales

    Polyporales


    Major microbiology

    Dr. OkkySetyawatiDarmaputra

    FUNGI ON FOODSTUFF AND THEIR MYCOTOXIN

    RESEARCH TITLE (Year 2009) : Population of Aspergillusflavusand Aflatoxin B1 Contents from Processed Peanut Products in Municipality of Bogor.

    ACTIVITIES : • Survey of processed peanut product consumptions

    • Sampling method of processed peanut products

    • Determination of A. flavus population and aflatoxin B1 contents

    EXPECTED OUTPUT:informationson A. flavus population and the levels of aflatoxin B1 in processed peanut products at retail levels


    Major microbiology

    J. curcas

    Curcuma sp.

    a b. c.

    a b. c..

    a b. c..

    a b. c..

    a b. c..

    a b. c.

    T. caccao

    P. falcataria

    Dr. Ir. Nampiah Sukarno

    • Research Interest:

    • Biology and Application of Phosphate Solubilizing Fungi

    • Biology and Application Mycorrhizal Fungi

    P. macrocarpa

    Development of Aspergillus carrying GFP gene for studying the ecological and colonization process

    P. macrocarpa

    • Green house

    • Control, b. A. niger, c. AMF

    Post tin mining area

    Agriculture area


    Major microbiology

    Edible Ectomycorrhiza


    Major microbiology

    Dr. Ir. GayuhRahayu

    • Research Interest:

    • Artificial Production of agarwood (Jin-koh) in planta and in vitro culture:

      • Inoculant Production

      • Mechanisms of terpenoid production

      • Inoculation Techniques

    Student involved ( 3 master students)

    • Manipulation of Soil Fungi for Forest Tree Growth and Health

    • Fungal decomposer of Shorea and Dryobalanopslitterand plant growth regulator producers

    • (student involved: 1 master, 1 undergraduates)

    compost

    ZPT bioassay

    Thermophilic Fungi

    • Amylolytic Fungi and its fermentation capacity for ethanol production

    • - Screening of potential mold and yeast


    Major microbiology

    Dr.Ir. Lisdar A.M. Sudirman

    • Research Interest:

    • Mushroom Biology and Biotechnology

    • Mushroom Antimicrobial activity


  • Login