1 / 79

The Wonderful World of Repressors

The Wonderful World of Repressors. Supriya Pokhrel, Firras Garada, Sonia Sharma, Kristen Wade, Trevor Faske, Mandi Feinberg. Background. - Repressor protein binds to upstream promoter regions - blocks transcription of downstream genes - allows for regulation of lytic vs. lysogenic cycles.

aliza
Download Presentation

The Wonderful World of Repressors

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. The Wonderful World of Repressors Supriya Pokhrel, Firras Garada, Sonia Sharma, Kristen Wade, Trevor Faske, Mandi Feinberg

  2. Background - Repressor protein binds to upstream promoter regions - blocks transcription of downstream genes - allows for regulation of lytic vs. lysogenic cycles

  3. Conserved Domains of Repressor Proteins in Mycobacteriophages By Supriya Pokhrel

  4. Repressor and its domains Is the repressor conserved mostly in the C-terminal domain or N-terminal domain of various phages?

  5. LIST OF PHAGES THAT HAVE SIMILAR REPRESSOR PROTEIN

  6. Motifs compared to lambda phage

  7. Protein Sequence of λ Repressor CTD Sequence

  8. Conserved regions were found mostly in the C-Terminal domain

  9. References Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994. Bell, Charles E. “Crystal Structure of the λ Repressor C-Terminal Domain Provides a Model for Cooperative Operator Binding.” Cell Press, June 23 2000. Volume 101, 801-811. Ganguly, Tribid and Bandhu, Amitava. “Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different operator DNAs with variable affinity.” Virology Journal 2007, 4:64.

  10. CI Repressor Protein in Lactococcus Phage TP901 and like Proteins By Firras Garada

  11. Background Info • Mor First Protein Transcribed = Lytic State • CI First Protein Transcribed = Lysogenic Stage

  12. Claim and So What Claim – When the CI repressor protein was mutated it can block transcription of MOR protein So what – Do other phages have a protein similar to the CI repressor protein that may function the same?

  13. Top Hits for Proteins Similar to Repressor Protein of TP901 (tp901-1.p-tp901-1p04)

  14. Motif Results

  15. Data • From the Motif Comparison there are 5 other proteins that are closely related to the Repressor Protein of tp901 • However 4 of those are other Lactococcus Phages • BUT one was an Enterococcus Phage

  16. Alignment of Comparison

  17. Conclusion • It is highly probably that other Lactococcus phages have a protein similar to the original CI repressor protein • It is probable that Enterococcus Phage phiEf11 may also have a protein very similar to the original Ci repressor and may also be mutated to control what pathway the phage takes

  18. References • Characterization of the CI Repressor Protein Encoded by the Temperate Lactococcal Phage TP901-1 Margit Pedersen, MałgorzataLigowska, Karin Hammer J Bacteriol. 2010 April; 192(8): 2102–2110. Published online 2010 January 29. doi: 10.1128/JB.01387-09 • http://biobike.csbc.vcu.edu/

  19. Presented by Sonia Sharma BNFO 301 Locating the Repressor Binding Sites in the Bacteriophages

  20. Repressors What are They • Repressor are proteins when present can lead to Lysogenic pathway • Block the PR (lytic) promoter, facilitating the binding of RNA polymerase to the PRM (lysogenic) promoter • Leading to synthesis of CI (orange) Repressor • They bind to specific, upstream sequences CONIDENTIAL

  21. Model- E.Coli phage lambdaRepressor-CI • Ideal binding sites in e-lambda OR1 OR2 • Repressor binds as a Dimer at specific palindromic sequences Anti-Repressor Phage Repressor CONFIDENTIAL

  22. Intergenic sequence CATACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATGTACTAAGGAGGTTGTATG CONFIDENTIAL

  23. Method • Similar sequences were found in known phages- e-lambda, L5, Che12 BXb1 • Two unknown phages- • Packman • Shaka CONFIDENTIAL

  24. CONFIDENTIAL

  25. CONFIDENTIAL

  26. CONFIDENTIAL

  27. Graphical map of e-lambda/che12 CONFIDENTIAL

  28. CONFIDENTIAL

  29. CONFIDENTIAL

  30. CONFIDENTIAL

  31. CI repressor in e-lambda has fewer binding sites • L5 and Bxb1 - Genome contains large number of binding site (29 and 34 each) in intergenicregions in only one orientation relative to transcription direction. • Che12 has 16 such sites also located in non coding region close to start and stop codon, orientation of sites correlates to the direction of transcription • Shakaand Packman each show 16 and 18 putative sites each 21 nucleotides wide • Protein alignment- L5, Bxb1 and Che12 more similar then e-lambda Observations CONFIDENTIAL

  32. Concluding thoughtDo majority of Phages follow e-lambda style or L5 yet to be analyzed CONFIDENTIAL

  33. References Source- Jeff Elhai, Gene Regulation and Phage, Center for the Study of Biological Complexity, Virginia Commonwealth University Gomathi, N S, Sameer, H, Kumar, V, et al. (2007). In silico analysis of mycobacteriophage che12 genome: Characterization of genes required to lysogenise mycobacterium tuberculosis. Computational biology and chemistry, 31(2), 82-91. Oppenheim, A B, Kobiler, O, Stavans, J, et al. (2005). Switches in bacteriophage lambda development. Annual review of genetics, 39, 409-429. CONFIDENTIAL

  34. By: Kristen Wade Indirect Readout Sites of the Repressor-Operator Complex

  35. Repressor-DNA Interaction Repressor Protein (two subunits) Image adapted from: http://www.acsu.buffalo.edu/~koudelka/

  36. Repressor-DNA Interaction Contacted bases Repressor Protein (two subunits) Contacted bases Image adapted from: http://www.acsu.buffalo.edu/~koudelka/

  37. Repressor-DNA Interaction Contacted bases Repressor Protein (two subunits) Bases NOT contacted by protein Contacted bases Image adapted from: http://www.acsu.buffalo.edu/~koudelka/

  38. Repressor-DNA Interaction Do these non-contacted nucleotides have a function in protein-DNA binding? Contacted bases Bases NOT contacted by protein Contacted bases Repressor binding sites of phage P22 From: Wu et al (1992) J Biol Chem 267:9234-9239 Image adapted from: http://www.acsu.buffalo.edu/~koudelka/

  39. Importance • Essential for structural adjustment of DNA that allows protein interaction with contacted bases • Wu et al, 1992

  40. Can these sites be identified and given functional significance in phages whose repressors are unrelated to P22?

  41. Identification 1. Centrally located within operator motifs

  42. Identification 1. Centrally located within operator motifs 2. Surrounded by a palindromic sequence ATAAG--------CTTA T

  43. Identification Nucleotide Frequency 1. Centrally located within operator motifs 2. Surrounded by a palindromic sequence 3. Display greater sequence diversity than surrounding positions A = solid line C = _._. G = _ _ _ _ T = ---- Nucleotide Position

  44. Application • Operators were collected using Motifs-In Upstream-Sequences-Of Repressor Protein of specific phage

  45. E. Coli phage Lambda

  46. Lambda

  47. Lambda

  48. Lambda

  49. Lambda Chi Squared: Sum of (O-E)^2 E

More Related