Naming enzymes
This presentation is the property of its rightful owner.
Sponsored Links
1 / 40

Lipase: protein that hydrolyses lipids Polymerase: protein that builds polymers PowerPoint PPT Presentation


  • 86 Views
  • Uploaded on
  • Presentation posted in: General

Naming enzymes. Lipase: protein that hydrolyses lipids Polymerase: protein that builds polymers Ligase: protein that ligates DNA fragments Proteinase or protease: protein that hydrolyses proteins DNase: protein that hydrolyses DNA RNase: protein that hydrolyses RNA.

Download Presentation

Lipase: protein that hydrolyses lipids Polymerase: protein that builds polymers

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Naming enzymes

Lipase: protein that hydrolyses lipids

Polymerase: protein that builds polymers

Ligase: protein that ligates DNA fragments

Proteinase or protease: protein that hydrolyses proteins

DNase: protein that hydrolyses DNA

RNase: protein that hydrolyses RNA


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Quiz 1 closes tomorrow morning 9 am

Tomorrow 4 pm in T4 Prac room:

safety and lab induction by Vance Lawrence


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Lecture 4

Basic methods

PCR and mutation

Adapted from David Tscharke @ RSB


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Lecture overview

  • Hybridisation

  • Melting temperature

  • Cutting DNA

  • Restriction endonucleases

  • Polymer chain reaction (PCR)

  • hybridisation

  • DNA amplification

  • mutation


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Watson and Crick

Nucleic acid base-pairing relies on hydrogen bonds being stronger than the repulsive force of the –ve charge on the backbones


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Base pairing is reversable

Denaturation

Melting

Hybridisation

Annealing

Renaturation


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Manipulating base pairing

Low salt

High temp

High pH

Low ‘G+C’

High salt

Low temp

High ‘G+C’


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Hybridisation jargon I

  • Tm: temperature at which hybrids are 50% melted

  • Equilibrium point between melting and annealing


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Hybridisation jargon II

  • Stringency: ease at which hybrids form

  • Stringent conditions favour fidelity

  • Tm is used to standardize stringency

  • There are two rules to work out Tm

  • one for short lengths of DNA

  • one for longer (> 30 bp) lengths


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Primer design

Coming to a tute near you soon!


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Calculating Tm (in oC)

  • For fragments > 30 bp

  • DNA-DNA hybrids:

    • Tm = 16.6log[Na+] + 0.41(%G+C) + 81.5

  • RNA-RNA hybrids:

    • Tm = 79.8 + 18.5log[Na+] - 0.584(%G+C) + 11.8(%G+C)2

  • DNA-RNA

    • The average of DNA-DNA and RNA-RNA

  • For short DNA (oligonucleotides)

  • Rule of thumb: 4 (# of C or G) + 2 (# of A or T)

    • Assumes physiological salt (0.9% NaCl or ~100 mM)


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Stringency and fidelity

DNA sequences

(A – F)

DNA sequence

(A)

Non-stringent (Tm – 30 ºC)

Stringent (Tm – 15 ºC)

temperature

rises

mismatches tolerated

hi-fidelity

Alberts


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

The key is to bias the outcome

If you want highly stringent hybridisation

- keep temperature high

- in some applications can use lower salt

- in some applications can add formamide

- can sometimes choose sequence

If you want ‘sloppy’ hybridisation

- use lower temperature


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

PCR

Revolutionized molecular biology


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

DNA

pol

5’

3’

PCR is a polymerase-based method

3’

5’

Polymerases need?

  • Primers

  • dNTPs (dATP, dCTP, dGTP, dTTP)

  • The right buffer / temperature conditions

  • Same goes for PCR


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Both strands of DNA are copied in PCR

5’

3’

3’

5’

+ 2 primers

+ polymerase

+ dNTPs

Denature

5’

3’

3’

5’


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

The copying is repeated…

Old and new DNA strands can be templates

original template

original template

Denature

Primers, pol, dNTPs all still there!

orig.

orig.

The primers define the length of the copies made from the new templates


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

PCR is a dance with 3 steps

100

Denaturation

Temperature

(ºC)

90

80

70

Extension

60

50

Annealing

1

2

3

4

5

6

7

Time (min)

Adapted Brown 9.6


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

What kind of enzyme works at 72 oC?

  • In the beginning, PCR used Klenow subunit

  • C-terminal part of E. coli Pol I

  • Not heat stable

  • DNA synthesis done at 37 oC

  • More had to be added in every cycle

  • The breakthrough came from Thermus aquaticus

  • Likes it hot

  • Has a polymerase that works best at 72 oC = Taq

  • Allowed automation of PCR

  • Higher stringency for primer binding

  • Taq named ‘molecule of the year’ in 1989 by Science


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Amount of

PCR

product

0 10 20 30 40

Number of cycles

Theory versus reality

  • DNA amplification by PCR is not exponential

  • Approaches exponential for first ~20 cycles


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Limitations to amplification

  • Limitation of primer or nucleotides

  • Amount of primers and nucleotides in the reaction mix can become exhausted

  • Lifetime of the polymerase

  • Even Taq doesn’t like 94 oC for too long

  • Competition between template and primer

  • Newly synthesised DNA strands compete with the primers for annealing to the DNA for use as template


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Limitations associated with Taq

  • Only good for relatively short stretches

  • Error rate is about 1 in 9,000 nucleotides

  • 5 kb is about the limit for Taq

  • PCR products have errors

  • Errors made in early cycles are multiplied

  • 1 in every 300 bp by the end of 30 cycles

  • Both problems arise because Taq lacks ‘proof-reading’ ability

  • 3’→ 5’ exonuclease activity to remove misincorporated bases

  • Some errors cause Taq to stall


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Alternatives to Taq

  • A variety of thermostable polymerases that have proof-reading ability have been found

  • Essential if fidelity of sequence is important

  • Taq remains the most commonly used polymerase for PCR

  • Cheap, robust

  • Vent is a polymerase with 3’→5’ proof-reading

  • Similar cost as Taq but 10-fold higher fidelity

  • Phusion is a polymerase with 3’→5’ proof-reading

  • 50-fold lower error rate than Taq

  • Can amplify 10 kb plasmids reliably

  • 3 times more expensive than Taq


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Controls for PCR

  • PCR turns a few copies into hundreds of millions

  • Any error made in the beginning is also amplified

  • Contamination of product into reagents is a hazard

  • A big issue in diagnostic and forensic applications

  • Separate rooms can be used for DNA extraction, reaction preparation and analysis of products

  • Be skeptical of PCR-based claims

  • A ‘water’ control is essential if you are claiming detection of a DNA sequence by PCR

  • For preparative PCR, contamination is less of an issue

  • e.g. just making more of a particular DNA sequence


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Parameters that affect PCR

EVERYTHING!

Primers and annealing temperature most important

Easy when starting from plasmid rather than genomic DNA


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Choosing the right parameters

  • Too short = lack of specificity

  • A given 8-mer appears ~46,000 times / genome by chance

  • Too long = annealing temperature becomes too high

  • Also… longer primers are more likely to have errors

  • …and you’ll go broke (oligos are charged by the bp)

  • 17 – 25 bp is usually good

  • Want Tm to be around 55 – 65 oC

  • Tm more important than G+C content

    • Choose closer to 50% G+C if you have the choice

  • - 3’-end should be a G or C if possible

  • Avoid runs (AAAAA or CCCC) and self-complementarity


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Choosing the right primer pair

Sense, 5’ or forward primer

Binds to the BOTTOM strand

5’

3’

3’

5’

Anti-sense, 3’ or reverse primer

Binds to the TOP strand

  • Naming is with respect to the sequence of the TOP strand

  • Primers (like all DNA) written 5’→ 3’

  • Sense primer will have the same sequence as the top strand

  • Anti-sense primer will be the complement of the top strand

  • Match Tm

  • Compensate for GC differences by changing lengths

  • Avoid pairs that bind to each other


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Choosing the right annealing temperature

  • Too low promotes promiscuous priming

  • Non-specific products

  • Too high and you get no priming

  • Rough calculation of Tm (in oC)

  • 4x(# of G or C) + 2x(# of A or T)

  • Annealing temperature is generally between Tm and Tm – 5 oC

  • Can have only one annealing temperature!

  • - Must be OK for both primers


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Primer

CGTTGCTGATAGGATC

Template

(wrong)

GCA CGA TAT CTAG

T

T

G

The problem of mispriming in early cycles

Primer

CGTTGCTGATAGGATC

GCAACGACTATCCTAG

Template

ThiswrongDNAnow has a perfect primersequence on the end

Will propagate as efficiently as the desired product in future cycles


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Refinements

For fidelity

It’s most important to reduce mispriming in early cycles:

Hot-start

- combine reagents cold and start the first cycle by placing

sample in a well that has been pre-heated at 94 oC

- stops mispriming as the sample warms up in first cycle


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

PCR success / failure

  • Well designed primers, good quality template

  • Little trouble

  • Little need for optimisation or refinement

  • It just works

  • Bad primers or tricky templates (e.g. high G=C)

  • Big trouble

  • Lots of optimization

  • Much misery!


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Summary

  • PCR is a powerful technique that allows amplification of a chosen sequence of DNA

  • Each new strand of DNA can become a template

  • The power of PCR is also its Achilles heel

  • Controls without input template are important

  • Taq is an error-prone enzyme

  • Errors in early cycles are amplified

  • Good primers and the right annealing temperature are the key to successful PCR

  • Adequate Tm for primers, suitable annealing temperature


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Changing the nucleotide sequence by PCR

New restriction sites

Site-directed mutagenesis


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

5’

CGAGAATTC

3’

CCTTACGCGATTACTGACAGG

AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCT

3’

5’

PCR can add new ends to insert

The 5’ end of a PCR primer does not need to match the template


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

5’

CGAGAATTC

3’

CCTTACGCGATTACTGACAGG

AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCT

3’

5’

New ends by PCR

  • Add useful restriction sites to the 5’ end of primers

  • Make sure the Tm of the template-specific part is still OK

  • If adding RE, need extra bases so the RE site is not right on the end

EcoRI

Always:

purify PCR product (agarose gel)

purify linearized vector (agarose gel)


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Protein mutation by PCR I

  • Selectively replace a codon for a new one

  • PCR with mutation primers

  • Mismatch at the mutation site

z

z

  • 2 PCR reactions

  • Red primers

  • Blue primers

z


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Protein mutation by PCR II

Mixing and annealing the PCR products

  • During 3rd PCR with the original terminal primers

  • Primer extension completes one of the duplexes

z

z

z

z

  • Amplification of full-length product

z


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCT

3’

5’

Protein mutation by PCR III

  • Good mutation primers

  • have about 1.5 times more nucleotides downstream than upstream of the mutation site

  • match the Tm of the other primers

  • end with a G or C at the 3’ end

z

GCGATTACTGAACAGCCTGTA

3’

5’


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

PCR primers

  • $0.4 per nucleotide

  • Up to 30mer is usually reliable

  • Up to 60mer may be OK

  • Longer sequences need gel purification

  • Much longer sequences need confirmation by sequencing

  • A good primer makes a GC base pair at the 3’ end


Lipase protein that hydrolyses lipids polymerase protein that builds polymers

Summary

  • PCR for changing DNA and mutating proteins

  • Primer design

  • Add/insert/delete nucleotides

  • Only Tm of matching segments matters

  • Inserts and deletions of any length possible


  • Login