Is behavior caused by genes or environment?
Download
1 / 31

Is behavior caused by genes or environment - PowerPoint PPT Presentation


  • 292 Views
  • Uploaded on

Is behavior caused by genes or environment?. Is behavior caused by genes or environment? Can the environment influence the function of genes?. Gene sequence is inherited (you’re stuck with what you have). atgtcagccgataactgactgatcgtaaattgagtttt. gene. However:

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Is behavior caused by genes or environment' - ainslie


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Is behavior caused by genes or environment?

Can the environment influence the function of genes?


Gene sequence is inherited (you’re stuck with what you have)

atgtcagccgataactgactgatcgtaaattgagtttt

gene

However:

Gene expression is influenced by inheritance AND age, tissue type, physical environment and social environment

protein

“gene expression” = mRNA abundance

messenger RNA

(mRNA)

atgtcagccgataactgactgatcgtaaattgagtttt

gene


Variation in gene sequence (DNA polymorphisms) can be found by “gene mapping” and DNA sequencing

atgtcagccgataactgactgatcgtaaattgagtttt

atgtcagccgataactgactgatggtaaattgagtttt

DNA polymorphism

Variation in gene expression can be found using “microarrays”

protein

“gene expression” = mRNA abundance

messenger RNA

(mRNA)

Microarrays measure mRNA abundance for 1000s of genes simultaneously

atgtcagccgataactgactgatcgtaaattgagtttt

gene


Behavioral division of labor in the honey bee colony by “gene mapping” and DNA sequencing


Behavioral division of labor in the honey bee colony by “gene mapping” and DNA sequencing


Behavioral division of labor in the honey bee colony by “gene mapping” and DNA sequencing

Age at onset of foraging is socially regulated

50

40

30

% introduced bees that initiated foraging by day 14

20

10

10

20

30

40

% old foragers in colony


Behavioral division of labor in the honey bee colony by “gene mapping” and DNA sequencing

Age at onset of foraging is socially regulated

Inhibitory social pheromone

Forager

Nurse


Behavioral division of labor in the honey bee colony by “gene mapping” and DNA sequencing

Age at onset of foraging is also genetically variable

60

% of introduced bees foraging at 15 days of age

40

20

0

m

c

l

m

c

l

m

c

l

Introduced bees

Host colony

m

c

l

m, c and l are different genetic strains


Honey bee brain microarray by “gene mapping” and DNA sequencing

Each pair of spots is a “detector” for mRNA abundance for 1 bee gene.

We can analyze mRNA abundance for ~5500 different genes at the same time (in a single dissected bee brain)


Comparing gene expression in a nurse brain vs. a forager brain

Dissected

nurse brain

Dissected

forager brain

labeling reaction

microarray hybridization

Forager mRNA level

Nurse mRNA level


Do age-related changes in behavior involve changes in gene expression in the brain?

“Typical” host colonies

(ca. 40,000 mixed-age bees)

Collect marked bees

day 7

day 30

~700 one-day-old bees

(marked)

Young

nurses

(n = 18)

Old foragers

(n = 18)


YN expression in the brain?

OF

Yellow = high mRNA

abundance

Blue = low mRNA

abundance

YN = young nurse

OF = old forager

About 1/3 of genes expressed in the bee brain show differences in expression!

But…

Are gene expression differences really associated with behavior differences or with age?

Genes

Bee brains


YN expression in the brain?

OF

Yellow = high mRNA

abundance

Blue = low mRNA

abundance

YN = young nurse

OF = old forager

About 1/3 of genes expressed in the bee brain show differences in expression!

Genes

Bee brains


Changing age-demography in the colony (i.e., social environment) allows us to collect “precocious” young forgers and “over-aged” old nurses

Collect marked bees

~1500 one-day-old bees

(marked)

All bees are same age!!!

day 7

day 30

Young

nurses

(n = 6)

Old nurses

(n = 6)

Young

foragers

(n = 6)

Old foragers

(n = 6)


YN environment) allows us to collect “precocious” young forgers and “over-aged” old nurses

OF

OF

YN

YF

ON

Yellow = high mRNA

abundance

Blue = low mRNA

abundance

YN = young nurse

YF = young forager

ON = old nurse

OF = old forager

Genes

Gene expression was primarily associated with behavior, not age!

Bee brains


YN environment) allows us to collect “precocious” young forgers and “over-aged” old nurses

OF

OF

YN

YF

ON

Yellow = high mRNA

abundance

Blue = low mRNA

abundance

YN = young nurse

YF = young forager

ON = old nurse

OF = old forager

Genes

Bee brains


Although 1/3 genes show differences, only ~50 genes are needed to “predict” whether a bee is a nurse or a forager

(Whitfield, Cziko & Robinson. Science 2003, 302: 296)

Y = young (7 ±2 days)

O = old (30 ±2 days)

N = Nurse

F = Forager

Single-cohort (age-matched)

bees

Typical colony

bees

>2

1.5

1.25

1

0.8

0.67

<0.5

mRNA level


Is gene expression in the brain a cause or consequence of behavior?

?

  • Brain gene expression

  • Upstream regulation of behavior

Behavior

-- or --

?

  • Brain gene expression

  • Consequence of behavioral activity, experience or environmental differences

Behavior


Is gene expression in the brain a cause or consequence of behavior?

Direct test of causation:

Manipulate gene expression in brain

Effects on behavior?


Is gene expression in the brain a cause or consequence of behavior?

Direct test of causation:

Manipulate gene expression in brain

Can’t do this yet –

need transgenics!!!

Effects on behavior?


Is gene expression in the brain a cause or consequence of behavior?

?

  • Brain gene expression

  • Upstream regulation of behavior

Behavior

-- or --

?

  • Brain gene expression

  • Consequence of behavioral activity, experience or environmental differences

Behavior


Brain gene expression in the absence of task-related experience

Caged bees

(no task-related experiences)


Brain gene expression in the absence of task-related experience

Social cue or treatment that accelerates the onset of foraging

Forager-like changes in brain gene expression?

Caged bees

(no task-related experiences)


Brain gene expression in the absence of task-related experience

Social cue or treatment that accelerates the onset of foraging

Forager-like changes in brain gene expression?

Social cue or treatment that delays the onset of foraging

Nurse-like changes in brain gene expression?

Caged bees

(no task-related experiences)


Juvenile hormone analog (methoprene) accelerates the onset of foraging and causes forager-like changes in brain gene expression (in the absence of experience)

“marker” genes

Treat with methoprene

(JH analog)

Caged bees

(no task-related experiences)

Whitfield CW et al. PNAS. 2006. Oct 31; 103(44):16068-75.


Queen mandibular pheromone (QMP) delays the onset of foraging and causes nurse-like changes in brain gene expression (in the absence of experience)

“marker” genes

Treat with QMP

Caged bees

(no task-related experiences)

Grozinger CM, Sharabash NM, Whitfield CW, Robinson GE. PNAS. 2003. Nov 25; 100:14519


Is behavior caused by genes or environment? foraging and causes nurse-like changes in brain gene expression (in the absence of experience)

Can the environment influence the function of genes?


Many behaviors… but how many involve gene expression differences?

Undertaker

(corpse-remover)

Comb-builder

Forager

Guard

Nurse

Gene clusters

(expression level in brain)

> 2

1.5

1.25

1

0.8

0.67

< 0.5


Are gene expression changes robust at the level of individual?

Can gene expression profile in an individual bee’s brain be used to correctly predict behavioral group?


“Leave-one-out” cross-validated class prediction individual?

“Test set”

  • Method:

  • Computer identifies a set of “predictor genes” for behavior using expression data from the 59 bees in the “training set.”

  • Computer attempts to classify the single “test” bee based on its expression of the predictor genes.

  • Repeat iteratively for all 60 individual bees.

  • Result:

  • Computer can correctly assign behavior group for 57 out of the 60 bees.

“Training set”

1 bee

(computer attempts to classify)

59 bees

(computer knows behavior)

nurse or forager?


ad