Is behavior caused by genes or environment?
This presentation is the property of its rightful owner.
Sponsored Links
1 / 31

Is behavior caused by genes or environment PowerPoint PPT Presentation


  • 254 Views
  • Uploaded on
  • Presentation posted in: General

Is behavior caused by genes or environment?Can the environment influence the function of genes?. . . . Gene sequence is inherited (you're stuck with what you have). . However:Gene expression is influenced by inheritance AND age, tissue type, physical environment and social environment. atgtcagc

Download Presentation

Is behavior caused by genes or environment

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Is behavior caused by genes or environment

Is behavior caused by genes or environment?


Is behavior caused by genes or environment

Is behavior caused by genes or environment?

Can the environment influence the function of genes?


Is behavior caused by genes or environment

Gene sequence is inherited (youre stuck with what you have)

atgtcagccgataactgactgatcgtaaattgagtttt

gene

However:

Gene expression is influenced by inheritance AND age, tissue type, physical environment and social environment

protein

gene expression = mRNA abundance

messenger RNA

(mRNA)

atgtcagccgataactgactgatcgtaaattgagtttt

gene


Is behavior caused by genes or environment

Variation in gene sequence (DNA polymorphisms) can be found by gene mapping and DNA sequencing

atgtcagccgataactgactgatcgtaaattgagtttt

atgtcagccgataactgactgatggtaaattgagtttt

DNA polymorphism

Variation in gene expression can be found using microarrays

protein

gene expression = mRNA abundance

messenger RNA

(mRNA)

Microarrays measure mRNA abundance for 1000s of genes simultaneously

atgtcagccgataactgactgatcgtaaattgagtttt

gene


Is behavior caused by genes or environment

Behavioral division of labor in the honey bee colony


Is behavior caused by genes or environment

Behavioral division of labor in the honey bee colony


Is behavior caused by genes or environment

Behavioral division of labor in the honey bee colony

Age at onset of foraging is socially regulated

50

40

30

% introduced bees that initiated foraging by day 14

20

10

10

20

30

40

% old foragers in colony


Is behavior caused by genes or environment

Behavioral division of labor in the honey bee colony

Age at onset of foraging is socially regulated

Inhibitory social pheromone

Forager

Nurse


Is behavior caused by genes or environment

Behavioral division of labor in the honey bee colony

Age at onset of foraging is also genetically variable

60

% of introduced bees foraging at 15 days of age

40

20

0

m

c

l

m

c

l

m

c

l

Introduced bees

Host colony

m

c

l

m, c and l are different genetic strains


Is behavior caused by genes or environment

Honey bee brain microarray

Each pair of spots is a detector for mRNA abundance for 1 bee gene.

We can analyze mRNA abundance for ~5500 different genes at the same time (in a single dissected bee brain)


Is behavior caused by genes or environment

Comparing gene expression in a nurse brain vs. a forager brain

Dissected

nurse brain

Dissected

forager brain

labeling reaction

microarray hybridization

Forager mRNA level

Nurse mRNA level


Is behavior caused by genes or environment

Do age-related changes in behavior involve changes in gene expression in the brain?

Typical host colonies

(ca. 40,000 mixed-age bees)

Collect marked bees

day 7

day 30

~700 one-day-old bees

(marked)

Young

nurses

(n = 18)

Old foragers

(n = 18)


Is behavior caused by genes or environment

YN

OF

Yellow = high mRNA

abundance

Blue = low mRNA

abundance

YN = young nurse

OF = old forager

About 1/3 of genes expressed in the bee brain show differences in expression!

But

Are gene expression differences really associated with behavior differences or with age?

Genes

Bee brains


Is behavior caused by genes or environment

YN

OF

Yellow = high mRNA

abundance

Blue = low mRNA

abundance

YN = young nurse

OF = old forager

About 1/3 of genes expressed in the bee brain show differences in expression!

Genes

Bee brains


Is behavior caused by genes or environment

Changing age-demography in the colony (i.e., social environment) allows us to collect precocious young forgers and over-aged old nurses

Collect marked bees

~1500 one-day-old bees

(marked)

All bees are same age!!!

day 7

day 30

Young

nurses

(n = 6)

Old nurses

(n = 6)

Young

foragers

(n = 6)

Old foragers

(n = 6)


Is behavior caused by genes or environment

YN

OF

OF

YN

YF

ON

Yellow = high mRNA

abundance

Blue = low mRNA

abundance

YN = young nurse

YF = young forager

ON = old nurse

OF = old forager

Genes

Gene expression was primarily associated with behavior, not age!

Bee brains


Is behavior caused by genes or environment

YN

OF

OF

YN

YF

ON

Yellow = high mRNA

abundance

Blue = low mRNA

abundance

YN = young nurse

YF = young forager

ON = old nurse

OF = old forager

Genes

Bee brains


Is behavior caused by genes or environment

Although 1/3 genes show differences, only ~50 genes are needed to predict whether a bee is a nurse or a forager

(Whitfield, Cziko & Robinson. Science 2003, 302: 296)

Y = young (7 2 days)

O = old (30 2 days)

N = Nurse

F = Forager

Single-cohort (age-matched)

bees

Typical colony

bees

>2

1.5

1.25

1

0.8

0.67

<0.5

mRNA level


Is behavior caused by genes or environment

Is gene expression in the brain a cause or consequence of behavior?

?

  • Brain gene expression

  • Upstream regulation of behavior

Behavior

-- or --

?

  • Brain gene expression

  • Consequence of behavioral activity, experience or environmental differences

Behavior


Is behavior caused by genes or environment

Is gene expression in the brain a cause or consequence of behavior?

Direct test of causation:

Manipulate gene expression in brain

Effects on behavior?


Is behavior caused by genes or environment

Is gene expression in the brain a cause or consequence of behavior?

Direct test of causation:

Manipulate gene expression in brain

Cant do this yet

need transgenics!!!

Effects on behavior?


Is behavior caused by genes or environment

Is gene expression in the brain a cause or consequence of behavior?

?

  • Brain gene expression

  • Upstream regulation of behavior

Behavior

-- or --

?

  • Brain gene expression

  • Consequence of behavioral activity, experience or environmental differences

Behavior


Is behavior caused by genes or environment

Brain gene expression in the absence of task-related experience

Caged bees

(no task-related experiences)


Is behavior caused by genes or environment

Brain gene expression in the absence of task-related experience

Social cue or treatment that accelerates the onset of foraging

Forager-like changes in brain gene expression?

Caged bees

(no task-related experiences)


Is behavior caused by genes or environment

Brain gene expression in the absence of task-related experience

Social cue or treatment that accelerates the onset of foraging

Forager-like changes in brain gene expression?

Social cue or treatment that delays the onset of foraging

Nurse-like changes in brain gene expression?

Caged bees

(no task-related experiences)


Is behavior caused by genes or environment

Juvenile hormone analog (methoprene) accelerates the onset of foraging and causes forager-like changes in brain gene expression (in the absence of experience)

marker genes

Treat with methoprene

(JH analog)

Caged bees

(no task-related experiences)

Whitfield CW et al. PNAS. 2006. Oct 31; 103(44):16068-75.


Is behavior caused by genes or environment

Queen mandibular pheromone (QMP) delays the onset of foraging and causes nurse-like changes in brain gene expression (in the absence of experience)

marker genes

Treat with QMP

Caged bees

(no task-related experiences)

Grozinger CM, Sharabash NM, Whitfield CW, Robinson GE. PNAS. 2003. Nov 25; 100:14519


Is behavior caused by genes or environment

Is behavior caused by genes or environment?

Can the environment influence the function of genes?


Is behavior caused by genes or environment

Many behaviors but how many involve gene expression differences?

Undertaker

(corpse-remover)

Comb-builder

Forager

Guard

Nurse

Gene clusters

(expression level in brain)

> 2

1.5

1.25

1

0.8

0.67

< 0.5


Is behavior caused by genes or environment

Are gene expression changes robust at the level of individual?

Can gene expression profile in an individual bees brain be used to correctly predict behavioral group?


Is behavior caused by genes or environment

Leave-one-out cross-validated class prediction

Test set

  • Method:

  • Computer identifies a set of predictor genes for behavior using expression data from the 59 bees in the training set.

  • Computer attempts to classify the single test bee based on its expression of the predictor genes.

  • Repeat iteratively for all 60 individual bees.

  • Result:

  • Computer can correctly assign behavior group for 57 out of the 60 bees.

Training set

1 bee

(computer attempts to classify)

59 bees

(computer knows behavior)

nurse or forager?


  • Login