Microbial Genetics: From Genotype to Phenotype

1. Microbial Genetics:From Genotype to Phenotype Nucleic acid synthesis Protein Synthesis Heredity Genetic Recombination Microevolution

2. Microbial Genetics Review Nitrogenous base dNTP Base pairing DNA RNA Coding strand Template strand Notable differences in hereditary material in viruses, prokaryotes and eukaryotes Important basis for modern methods of identification and disease diagnosis

3. What does DNA do? Bacterial cell DNA transcription DNA replication: Cell Division requires duplication of DNA RNA translation Clones protein Large molecules of DNA are called chromosomes Bacteria have circular chromosomes and sometimes additional small, circular pieces of DNA called plasmids

4. Replication of DNA • Because DNA is double stranded replication can occur on each strand simultaneously in opposite directions • Continuous, newly synthesized strand added in 5’ to 3’ is leading strand • DNA synthesized from behind by the addition of Okazaki fragments is lagging strand, olignucleotides are still added to the 3’ end

5. DNA replication Original double stranded DNA Two new strands (green dotted lines) are created using a polymerase enzyme The process of creating the new strands is called polymerization

6. DNA polymerization Sugar phosphate backbone Nitrogenous bases 3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA…………….5’ 5’ATCGAACGGAGACTTACTCTTA3’ T DNA Polymerase A A G A T C C A G T A dNTPs are are added to the new strand (green) so that the dNTPs pair with the corresponding ones on the complimentary strand (black)

7. DNA Polymerization • Polymerization, requires DNA polymerase enzyme • Synthesis occurs only from 5’ to 3’ of new strand • dNTP incorporated into 3’ end of new strand by DNA polymerase • Formula for polymerization: (dNMP)nDNA +dNTP(dNMP)n+1DNA + PPi • (dNMP)nDNA is the growing strand • dNTP is the deoxynucleotide triphosphate • (dNMP)n+1DNA is the growing strand after a dNTP is added • iPP is inorganic diphosphate

8. Original strands are separated generating replication forks 5’ 3’ Synthesis occurs on both strands of original DNA in opposite directions Okazaki fragments Leading strand Lagging strands Leading strand

9. Nucleic acid polymerization 5’ Nitrogenous base Nitrogenous base Nitrogenous base Nitrogenous base Nitrogenous base Nitrogenous base Polymerase enzyme Nucleotide triphosphate Nitrogenous base Inorganic phosphate

10. Transcription is synthesis of RNA from DNA • NTPs (ATP, CTP, GTP, UTP) incorporated in to strand of mRNA (RNA polymerization) • mRNA is complementary to the template strand of DNA • RNA polymerase enzyme is used

11. What is a gene? tRNA rRNA DNA mRNA protein

12. Synthesis of mRNA Double stranded DNA has a coding strand (+) and template strand (-) 5’ 3’ + Original strands are separated where transcription is to begin mRNA synthesis occurs on the template strand (-) of original DNA

13. Synthesis of mRNA Template strand of DNA 3’TACCTTGCCTCTGAATGAGAATATGGCACCATCGAAA…………….5’ 5’AUGGAACGGAGACUUACUCUUA3’ U RNA Polymerase A A G A U C C A G U AUG is start codon A

14. Genetic Code for Building Proteins Every three bases (triplet) of DNA corresponds to a codon of mRNA which corresponds to an anticodon in tRNA which bares a specific amino acid Use the table in your book to provide the amino acids for the following DNA sequence on the coding strand : CGTCCCGTC

15. Eukaryotes DNA contains introns and exons I I I I I I I Exons have the code to build proteins

16. Components of Prokaryote Ribosome 21 different proteins 16SrRNA 30S subunit 31 different proteins 70S ribosome (prokaryotes) 23S rRNA and 5S rRNA 50S subunit

17. Ribosomes The site of protein synthesis Prokaryotes have 70S ribosomes Eukaryotes have 80S ribosomes Because ribosomes do such an important job drugs that inhibit them have drastic effects on the cell (many antibiotics and the toxin ricin inhibit protein synthesis by binding to ribosomes) The genes for ribosomal RNA are often used to measure the similarity between organisms 16SrRNA gene for bacterial systematics 18SrRNA gene for eukaryote systematics

18. Translation Growing polypeptide connected by enzymatic linkage between amino acids tRNA mRNA ribosome

19. Example of regulation of protein synthesis: Enzyme Induction Prom. Oper. Gene Pol. Substrate binds to repressor allowing polymerase to transcribe mRNA repressor mRNA substrate Enzyme synthesized Enzyme acts on substrate

20. Example of regulation of protein synthesis: Enzyme Induction Prom. Oper. Gene Pol. repressor Gene turned ‘off’ In the absence of substrate, the repressor blocks polymerase enzyme Note: the status of a gene being turned on or off is not heritable. While it allows individual organisms to adapt to changing circumstances, it does not effect the evolution of species as does mutation.

21. Mutation • Point mutation -results from the replacement of a nitrogenous base effects may 1. be “silent” causing no change in the protein structure, or 2. result in altered protein with different performance or 3. produce protein that doesn’t work • Frameshift mutation -results from the insertion or deletion of bases, has dramatic effects on protein, often deleterious.

22. The genetic code is analogous to written language Suppose the sentence below is a genetic sequence: the red fox ran out After a point mutation the sentence might be: the red fax ran out After a frame shift mutation (deletion of letter e) the sentence might be: thr edf oxr ano ut

23. Mutagens • Chemicals that bind to DNA and affect the process of replication or transcription. Some naturally occurring chemicals are mutagenic, many industrial chemicals are mutagenic • Radiation, including UV light, is mutagenic

24. Genetic Variation Results from Mutation Most mutations are either harmful, or neutral, but sometimes they are beneficial. If the mutations are not too harmful, they will be passed on to their progeny (offspring). This is the hereditary basis of evolution. These heritable changes in a lineage or populations of organisms over generations contribute to micro-evolution

25. Antibiotic Resistance in Bacteria • Bacteria can multiply rapidly into large populations that reach a stationary phase • Antibiotic therapy or accidental ingestion of antibiotics acts as an agent for natural selection • Single point mutation in DNA can lead to resistance in a single mutant bacterium • Mutant ‘lost in crowd’ until antibiotic therapy kills off susceptible bacteria • Mutant becomes dominant in population and gives rise to mutant clones

26. Variation by Mutation is Compounded by Genetic Recombination • Sexual reproduction • Bacterial transformation • Bacterial conjugation • Virus-mediated gene transfer • Other transfer between symbionts

27. Sexual reproduction is genetic recombination parent cells produced gametes by meiosis Gametes fuse to form a zygote zygote gametes

28. 2N diploid stage gametogenesis fusion of gametes 1N haploid stage sperm egg

29. Bacterial Transformation Heat-killed bacterium disintegrate and release DNA into surroundings Bacterium with gene for capsule Bacterium without gene for capsule Genes taken in and expressed

30. Conjugation • Plasmids may contain genes that allow a bridge (pilus) to form between two bacteria. Bacteria with these plasmids are F+ • The plasmid from the F+ (donor) bacterium is replicated and transferred to the F- (recipient) bacterium pilus F+ F- F+ F- 1. 2.

31. High frequency recombinations Plasmid inserts into chromosome chromosome F+ recipient Hfr+ Hfr+ DNA transferred into recipient and inserted into chromosome Hfr+ recipient

32. Transposable elements (jumping genes) • A mobile genetic sequence that can move from one plasmid sequence to another sequence or to a chromosome • May result in the disruption of gene activity • Make up a large portion of Eukaryote DNA

33. Transduction • Some viruses can incorporate their genetic material into the host’s chromosome • When the virus is transferred from host to host, some of the host’s genes can be transferred along with the virus’s genes into the next host.

34. Transduction Bacterium with its chromosome containing viral (Prophage) DNA Prophage DNA excised from host chromosome Phage infects new bacterium bringing with it DNA from the previous one Phage DNA inserts into new host chromosome along with bacterial genes