Roger prichard institute of parasitology mcgill university montreal canada
Download
1 / 26

Roger Prichard Institute of Parasitology McGill University, Montreal, Canada - PowerPoint PPT Presentation


  • 102 Views
  • Uploaded on

2007 – 2009 publications Macrocyclic lactone resistance: 1. Understanding resistance mechanisms to different MLs 2. Progress with possible markers for ML resistances. Roger Prichard Institute of Parasitology McGill University, Montreal, Canada. Ligand-gated ion channels.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Roger Prichard Institute of Parasitology McGill University, Montreal, Canada' - adora


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Roger prichard institute of parasitology mcgill university montreal canada

2007 – 2009 publicationsMacrocyclic lactone resistance:1. Understanding resistance mechanisms to different MLs2. Progress with possible markers for ML resistances

Roger Prichard

Institute of Parasitology

McGill University, Montreal, Canada



H. contortus GluClα3B expressed in Xenopus oocytes

The effects of ivermectin resistance-associated mutations on the ability of glutamate to activate H. contortus GluCl3B channels (mean SEM)

Mutation EC50 for L-Glutamate Hill Number

Wild type 27.6 ±2.7 1.89 ± 0.35

E114G 31.5 ± 3.2 1.48 ± 0.31

V235A 26.2 ± 2.5 1.97 ± 0.35

L256F 92.2 ± 3.5*** 1.09 ± 0.16**

T300S No channels

** p 0.01, *** p 0.001

Fig. 4. Dose-response curves for L-glutamate at mutant H. contortus

GluClα3B channels. , wild-type; ✖, V235A; , E114G; , L256F.

McCaverna et al. Mol. Pharmacol. 2009


Radioligand binding assays using

[3H]ivermectin and membrane

preparations from COS-7 cells transfected with wild-type and mutant H. contortus GluClα3B. The insets show the Scatchard plots for each mutant.

McCaverna et al. Mol. Pharmacol. 2009

The effects of mutations in H. contortus GluClα3B on binding of 3[H]ivermectin to membrane preps from transfected COS-7 cells. Mean± SEM

Mutation Kd 3[H]Ivermectin Binding, nM

Wild type 0.35 ± 0.1

E114G 0.39 ± 0.07

V235A 0.32 ± 0.09

L256F 2.26 ± 0.78***

L256W 2.51 ± 0.7***

L256Y 1.84 ± 0.49***

L256V 0.79 ± 0.24*

T300S 0.76 ± 0.25

* p< 0.05; *** p< 0.001


Annelies Van Zeveren in her Ph.D. studies looked for the L256F SNP, in GluClα3 homolog, in an ivermectin resistant strain of Ostertagia ostertagi that she and her colleagues had experimentally selected, but did not find the L256F mutation.

L256F, in GluClα3, may be quite rare in different nematode isolates. However, if it does occur it does seem to produce an ‘IVM-resistance phenotype’


A dopamine-gated ion channel (HcGGR3*) from Haemonchus contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance

Rao VT, Siddiqui SZ, Prichard RK, Forrester SG.

Mol Biochem Parasitol. 2009 Jul;166(1):54-61. Epub 2009 Mar 4.


Electrophysiology of HcGGR3 in contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceXenopus laevis oocytes

Response to dopamine

Response to other amines

HcGGR3 forms a homomeric channel and is primarily gated by dopamine

Rao et al. Mol. Biochem. Parasitol. 2009


Expression of contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceHcGGR3 in lab macrocyclic lactone (ML)-selected strains of Haemonchus contortus (♀)

qPCR: Standard curve relative quantification method

Fold change as compared to expression in PF23 strain

(normalized with 18srRNA)

Level of expression in PF23 strain

anova: P<0.0001

PF23: ML sensitive strain

IVF23&MOF23: Lab selectedstrains

HcGGR3 is down regulated in lab strains of ML- selected worms

Rao et al. Mol. Biochem. Parasitol. 2009


Genotyping of contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceHcggr3 for the region encoding 3’ UTR

(single ♂s)

GGTGGGTAAACGATAGATCAACTATATCGCACATAAAAAATACAATGCAAACACATATTTTGTAAACGTTAATTCCACCGTAGCCAATTAACCGTATAAATATGCAATTCAACCTAATTGAGTTGCATTATCACATTCGTTGATTTCTCTAAATGTAGAGAGTTGAGGAG

Homozygous: T/T

Heterozygous: T/C

Rao et al. Mol. Biochem. Parasitol. 2009

PF23: ML sensitive strain

IVF23&MOF23: Lab selected strains

N = 30

Selection of HcGGR3 allele in Macrocyclic lactone resistance


Pharyngeal pump rates of wild-type contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceC. elegans after 2.5 h exposure to 2-fold serial dilutions of IVM and MOX (mean ± SD). A circle ( ) represents pumping rate in non-treated worms, a triangle ( ) indicates pumping rate in IVM exposed worms and a square ( ) indicates pumping rate in MOX exposed worms.

Ardelli et al. 2009 Vet Parasitol


Motility phenotype of wild-type contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceC. elegans after exposure to 2.5 nM of drug (mean ± SD). A circle ( ) represents velocity in non-treated worms, a triangle ( ) indicates velocity in IVM exposed worms and a square ( ) indicates velocity in MOX exposed worms

Ardelli et al. 2009 Vet Parasitol


Transcriptional profiles of GluCl genes in wild-type contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceC. elegans after exposure to 2.5 nM of IVM or MOX for 2h (mean ± SD). The black bars represent gene transcription after exposure to IVM and the grey bars represent gene transcription after exposure to MOX. The y-axis represents the fold change in transcription relative to non-treated controls and listed along the x-axis is the C. elegans gene. Changes that are statistically different between the drug treatments (p < 0.05) following IVM or MOX exposure are indicated with .

Ardelli et al. 2009 Vet Parasitol


ABC transporters contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance


Half-transporters contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance

Merino et al. Drug Met. Disp. 2009

Natural Allelic Variants of Bovine ATP-Binding Cassette Transporter ABCG2: Increased Activity of the Ser581 Variant and Development of Tools for the Discovery of New ABCG2 Inhibitors

Selamectin was a significantly more potent inhibitor of the Tyr581 variant compared with the wild-type Ser581

Effect of the ivermectin (IVE) and selamectin (SEL)] on mitoxantrone (MXR) accumulation mediated by human ABCG2 and murine Abcg2. Transduced MDCKII cells were preincubated with or without Ko143 (1 µM) or the other tested compounds (50 µM). Mean MXR fluorescence is shown in terms of relative arbitrary units. The bars indicate the means ± S.D. ** p< 0.01, comparing the difference between human ABCG2- and murine Abcg2- transduced MDCKII cells. §§, p< 0.01, comparing the difference between IVE and SEL in murine Abcg2-transduced cells. §§§, p< 0.001, comparing the difference between IVE and SEL in human ABCG2-transduced cells.


IVM selection on contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceC. elegans

Cross-resistance to anthelmintics. C. elegans L1s in M9 buffer were incubated in serial dilutions of moxidectin (MOX), levamisole (LEV), albendazole (ALB) or pyrantel (PYR), and their fold-resistance determined in IVR6 (solid) and IVR10 (hatched) relative to Bristol N2 strain (1; dotted line).

James & Davey, Int. J. Parasitol. 2008


‘Natural’ IVM resistance in contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceC. elegans results in overexpression of a number of ABC transporter genes (Pgps & mrps)

ABC transporter gene expression in ivermectin-resistant Caenorhabditis elegans. pgp-1, pgp-2, mrp-1, mrp-2, mrp-5 and mrp-6 were amplified from cDNA using gene-specific primers in IVR6 (solid) and IVR10 (hatched) strains cultured with ivermectin. James & Davey, Int. J. Parasitol. 2008.


c-glutamylcysteine contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance

synthetase (gcs-1), the rate-limiting enzyme for glutathione synthesis was overexpressed in IVR10, while a glutathione transferase π(gstp-1) was overexpressed in IVR6

The expression of gcs-1 and gstp-1 (B) was examined in IVR6 (solid) and IVR10 (hatched) strains cultured on ivermectin. Bars show means ± SD of the fold change in gene expression relative to the Bristol N2 strain from 2 independent experiments.

* indicates P≤0.05; ** indicates P≤0.01. James & Davey, Int. J. Parasitol. 2008.


Allelic variation in an contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceOnchocerca volvulus ABC transporterwas reduced in IVM-treated human populations in Ghana in 1999

Ardelli & Prichard, Trans R Soc Trop Med Hyg. 2007, 101:1223


PLP (half-transporter) Genotype before contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance IVM and after 13X IVM: Onchocerca volvulus

BEFORE IVM

AFTER IVM 13x

P=0.054

50

45

40

P=0.029

35

Frequency

30

P=0.0077

25

20

P=0.048

15

P=0.048

Fisher’s exact test

10

5

0

AA GG TT

AG GG TT

AG CG TT

GG CG TT

AA CC AA

GG GG TT

AG CG AT

AA CG AA

AG GG AT

AG CG AA

AG GG AA

GG GG AT

AG CC AA

Female worms

Position 1 =AA/AG/GG

Position 2 =CC/CG/GG

Position 4 =AA/AT/TT

Pre IVM= 66

Post IVM=35

Allelic selection after 13 three-monthly doses of IVM in female worms

Loss of polymorphism. Bourguinat et al. 2008 Mol Biochem Parasitol


Mrp expression in contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceC. elegans following exposure to 2.5 nM IVM, compared with wild-type worms not exposed to drug

Mrp expression in C. elegans following expsure to 2.5 nM MOX, compared with wild-type worms not exposed to drug

B

Ardelli & Prichard J. Helminthol. in press


Thioredoxins and IVM resistance contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance

Analysis of H. contortus showed that expression of both thioredoxin 12-kDa (HcTrx1) and the 16-kDa (HcTrx3) genes were increased in an IVM-resistant strain relative to a sensitive strain.

Sotirchos, Hudson , Ellis & Davey. Free Radic Biol Med. 2008


β contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance-tubulin and ML resistance


β contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance-tubulin

H. contortus: Comparison of the frequency of 200TTC-phenylalanine, 200TTC/TAC-phenylalanine/tyrosine and 200TAC-tyrosine in unselected (PF), IVM selected (IVF) and MOX selected (MOF) strains

Tyr at amino acid 167 or 200: PF = 11.1%; IVF = 48.1%; MOF = 51.9%

Mottier & Prichard 2008 Pharmacogenetics & Genomics


Onchocerca volvulus tubulin female worms after 13 x ivm

BEFORE TX contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance

AFTER TX

Before and after 13 three-monthly doses

P=1e-8

Fisher’s exact test

P=1e-6

80

60

Frequency

40

20

0

aa

ab

bb

Genotype

Onchocerca volvulus: β- tubulin Female worms after 13 x IVM

N before=183

N after 4 doses=59

N after 13 doses=39

IVM selection caused a significant change in β-tubulin genotype

Bourguinat et al. 2007 PLoS NTD


TAC/TTC in contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistanceH. contortusβ-tubulin in Swedish flocks which had been under BZ or ML treatment

“An allele frequency of ≥65% was detected in one of the two flocks in 13 (29%) of the 45 farms examined. On many farms (24, 25, 33, 36, 37, 39, 42, 43 and 44) the allele frequency was similar in both the BZ and ML treated flocks”

Höglund et al. Vet Parasitol, 2009


Conclusions
Conclusions contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance

  • ML resistances appear to be multigenic

  • Phenotypic effects of IVM & MOX markedly different

  • Differences in genes implicated in IVM & MOX resistances

  • Possibly GluCls involved in ML resistances, but data not conclusive

  • ABC transporters induced & overexpressed in ML resistances, but not same between IVM & MOX

  • MLs select on β-tubulin

  • Thioredoxins may also be overexpressed in ML resistances


ad