slide1
Download
Skip this Video
Download Presentation
Figure 1

Loading in 2 Seconds...

play fullscreen
1 / 1

Figure 1 - PowerPoint PPT Presentation


  • 134 Views
  • Uploaded on

Figure 1. HIV polyA. wpre. Y. RRE. cPPT. 5’ LTR. H1. PGK. eGFP. D 3’ LTR. UGAGAUGCUUGGACGAAAA. W7-19/9. UUUUCGUCCAAGCAUCUCAUU. loop. TTTTT. U UGAGAUGCUUGGACGAAAA UGCUUGACG. W7-29/4. CGUCAAGCA UUUUCGUCCAAGCAUCUCA A UU. H1. H1. PGK. eGFP. U UCUCAGUUCUCUUCACUCA AGGAUUGUU.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Figure 1' - abrial


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Figure 1

HIV polyA

wpre

Y

RRE

cPPT

5’ LTR

H1

PGK

eGFP

D3’ LTR

UGAGAUGCUUGGACGAAAA

W7-19/9

UUUUCGUCCAAGCAUCUCAUU

loop

TTTTT

UUGAGAUGCUUGGACGAAAAUGCUUGACG

W7-29/4

CGUCAAGCAUUUUCGUCCAAGCAUCUCAAUU

H1

H1

PGK

eGFP

UUCUCAGUUCUCUUCACUCAAGGAUUGUU

W8-29/4

AACAAUCCUUGAGUGAAGAGAACUGAGAAUU

A

B

UCUCAGUUCUCUUCACUCA

W8-19/9

UGAGUGAAGAGAACUGAGAUU

UUCUCAGUUCUCUUCACUCAAGGAUUGUU

W8-29/9

AACAAUCCUUGAGUGAAGAGAACUGAGAAUU

GCGAUCUCAGUUCUCUUCACUCA

W8-miR

*

*

UGAGUGAAGAGAACUGAGACUGCUU

ad