Genetic evaluations past present and future
Download
1 / 59

Genetic Evaluations: Past, Present, and Future - PowerPoint PPT Presentation


  • 77 Views
  • Uploaded on

Genetic Evaluations: Past, Present, and Future. Curt Van Tassell USDA Agricultural Research Service AIPL – Animal Improvement Programs Laboratory BFGL – Bovine Functional Genomics Laboratory. [email protected] 301-504-6501. Background. Bovine Functional Genomics Laboratory (BFGL)

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' Genetic Evaluations: Past, Present, and Future' - abbott


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Genetic evaluations past present and future

Genetic Evaluations: Past, Present, and Future

Curt Van Tassell

USDA

Agricultural Research Service

AIPL – Animal Improvement Programs Laboratory

BFGL – Bovine Functional Genomics Laboratory

[email protected]

301-504-6501


Background
Background

  • Bovine Functional Genomics Laboratory (BFGL)

    • Structural and functional genomics of cattle

    • Emphasis on health and productivity

    • Bioinformatics (storage and use of genomic data)

  • Animal Improvement Programs Laboratory (AIPL)

    • “Traditional” genetic improvement of dairy cattle

    • Increasing emphasis on animal health and reproduction



Definitions
Definitions

  • Phenotype – actual measurements from the cow, affected by genotype, environment, and errors

    P = G + E + 

  • Predicted breeding value (PBV) – the expected (average) deviation of offspring

  • Predicted transmitting ability (PTA) – half the PBV – is our best guess of what deviation from an average would result in offspring from a parent

  • Pedigree index or parent average – estimated genetics of an animal, based solely on its sire and dam


Definitions more
Definitions – More…

  • Heritability – how much of the phenotype is controlled by genetics – do children resemble their parents?

  • Reliability – a measure of accuracy of prediction of genetic merit (specifically, the fraction of genetic variation captured in the predicted merit)

  • Repeatability – how much of the phenotype is controlled by the cow across records (as opposed to random noise and environment)


Traditional selection programs
Traditional Selection Programs

  • Estimate genetic merit for animals in a population

  • Select superior animals as parents of future generations


Genetic evaluation system
Genetic Evaluation System

  • Traditional selection has been very effective for many economically important traits

  • Example: Milk yield

    • Moderately heritable

    • ~30 million animals evaluated 4x/yr

    • Uses ~70 million lactation records

    • Includes ~300 million test-day records

    • Genetic improvement is near theoretical expectation


Dairy cattle genetics success

2000

Cows

Bulls

0

-2000

BV Milk

-4000

-6000

1960

1970

1980

1990

2000

Year of Birth

Dairy Cattle Genetics Success






Revised productive life
Revised productive life

  • DIM > 305 credited

    • Differential weighting by DIM gives some advantage to cows that calve more often

  • Heritability reduced from 8.5 to 8%

  • Implementation planned for August 2006 along with revised net merit index


Productive life credits current
Productive life credits - current

140

120

100

80

Credit (%)

60

40

1

2

3

20

0

0

1

2

3

4

5

Years


Productive life credits revised
Productive life credits – revised

140

120

100

80

Credit (%)

60

40

1

2

3

20

0

0

1

2

3

4

5

Years


Evaluation for stillbirth
Evaluation for stillbirth

  • Stillbirth – born dead or died within 48 hours

  • Reported for about half of calving-ease records

  • Evaluation and reporting similar to calving ease

  • To be included in Net Merit index

  • Implementation planned for August 2006


Stillbirth data
Stillbirth Data

Stillbirth Score



Animal model genetic evaluation
Animal Model Genetic Evaluation

  • Includes an animal (genetic) effect for all animals with data or in the pedigree

  • That genetic prediction is a complex combination of information from

    • Animal’s own performance

    • Sire and dam predicted genetic merit

    • Progeny predicted merit

  • All these genetic effects are inter-related

    • e.g., granddaughter performance trickles up to a sire through the dam


Animal model describes a cow's lactation

record as the sum of the effects

  • management group, m

  • genetic merit (animal effect), a

  • permanent environment, p

  • interaction of her herd and sire, c

  • unexplained residual, e

    For:

  • herd i

  • year-season, parity, and registry group j

  • sire k

  • daughter l


Calculation of pta
Calculation of PTA

w values depend on relative amounts of information: w1 + w2 + w3 = 1



Predicting genetic merit of a cow
Predicting Genetic Merit of a Cow

  • Just use pedigree prediction

    • Sire

    • Dam?

  • Just use phenotype –milk

  • Use a mixture of both!!


Pedigree based prediction
Pedigree-Based Prediction

PTA of a cow is average of the sire and dam PTA. So…

Cow PTA = ½ [Sire PTA + Dam PTA]

Cow PBV = [Sire PTA + Dam PTA]

Dam PTA = ½ [MGS PTA + MGD PTA]

This prediction has a maximum reliability of 50%






Pedigree based prediction1
Pedigree-Based Prediction

Cow PTA = ½ [Sire PTA + ½ MGS PTA]

This prediction has a maximum reliability of 37%


Phenotype based prediction
Phenotype-Based Prediction

Cow PTA = ½ Cow PBV

= ½ heritability * deviation from herd

Deviation accounts for environmental effects (herd, year, season), age and parity, stage of lactation, registry status, and other effects


Milk 30 heritabilty
Milk – 30% Heritabilty

25,000 Cow production

20,000 Herd Average

5,000 Deviation

1,500 PBV: predicted breeding value

30% * (+5000)

750 PTA: predicted transmitting ability

50% of breeding value


Scc 12 heritabilty
SCC – 12%Heritabilty

3.00 Cow phenotype

3.70 Herd Average

-.70 Deviation

-0.084 PBV: predicted breeding value

12% * (-0.70)

-0.042 PTA: predicted transmitting ability

50% of breeding value


Reliability accuracy
Reliability (Accuracy)

  • A measure of how confident we are about the PTA.

  • It ranges from 0 to .99, and increases with the added information.

  • Reliability depends on:

    • Number of information (reported as daughters equivalents)

    • Heritability



Daughter equivalents de
Daughter Equivalents (DE) Heritability

  • A measure to standardize value of information

  • Parents with accurate PTA are valuable

  • A phenotypic record is valuable

  • Daughters in many herds are most valuable.


Heritability h 2 and repeatability r
Heritability (h Heritability2) and Repeatability (r)

h2 r k Trait

.30 .55 11.3 Milk

.25 .40 14 Udder

.15 .25 24.7 Feet

.12 .25 31.3 SCS

.08 .135 48 Productive life

.04 .13 98 DPR

k = (4 - 2*herit) / herit


Examples of de and reliability
Examples of DE and Reliability Heritability

REL = DE / (DE + k)


Female selection
Female Selection Heritability

  • DHIA, animal ID, pedigree

    • Get optimal PTA from AIPL

  • Non-DHIA

    • Pedigree index derived PTA

    • Simple production derived PTA

    • Blended PTA


Fundamental principal
Fundamental Principal Heritability

  • Zero is defined arbitrarily in evaluation system!

  • Absolute values of PTA are meaningless

  • Example:

    • O Man PTA NM$ is 706

      • This does NOT mean that a daughter of O Man will earn you $706 more than her dam

    • Sharky has PTA NM$ of 599

  • What you can say is that ON AVERAGE an O Man daughter will earn 706-599 = $107 MORE than a Sharky daughter from the same cow



Genome project objectives
Genome Project Objectives Heritability

  • PHASE I - 8X Genome Sequence

    • Line 1 Hereford cow and her sire

    • 6 genome equivalents in fragments from Dominette (the cow)

    • 2 genome equivalents

      in fragments from

      Domino (sire) based on

      physical location

L1 Dominette 01449


Shotgun genome sequence
Shotgun Genome Sequence Heritability

AGCTTTAAGCCATACCTTAG . . . GACATTACCTAGGAGCTTTAAGCCATAC

AATGTACACACACACACAC . . . ACGTGCGTCGT

AACTGGTCTACAG . . . GTTCAACGTCCTTGAC

ATCGTTCAAGTATGCGTAAATCGTTGT . . . ACGTAATAGTACGT

GTCGTAACCTGA . . . TCAACTGGTACA

GTCGTACATGT . . . TGACGTAACTGA

TCAACTGGTACGT . . . ACTTCCAGGAGACCTGTATC

GCCACATGTAGCGT . . . TATGCGTATGTGTAAACGTGGGTACTA

GTGCAACCACTGTATGCGA . . . AGTTGTGCCACGT

AAACTACGTTGTTTACCAG . . . GTGGGACACTAGTGATCG

TTAGACGATATCG . . . TATGACACGTACGT


Shotgun assembly
Shotgun Assembly Heritability

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

...AGCTTTAAGCCATACCTTAGGACATTACCTAGG

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

GCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

Consensus

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...


Genetic markers

Polymorphism Heritability

“poly”= many“morph”= form

General

population

94%

Single nucleotide

polymorphism

(SNP)

6%

Genetic Markers

  • Allow inheritance to be followed in a region across generations

  • Single nucleotide polymorphisms (SNiP) are the markers of the future!

  • Need lots!

    • 3 million in the genome

    • 10,000 initial goal


Snp discovery
SNP Discovery Heritability

Brahman

Holstein

Jersey

Limousin

Hereford

Angus

Norwegian Red


Snp discovery1
SNP Discovery Heritability

  • Dominette data:

  • Consensus:

  • Martha:

...AGCTTTAAGCCATACCTTAGGACATTACCTAGG

GCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

...AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATAC...

...AGCTTTAAGCCATACCTTAGGATATTACCTAGGAGCTTTAAGCCATAC...

SNP


Validate and genotype snp
Validate and Genotype SNP Heritability

  • Characterize potential SNP across ~25 breeds

  • Preliminary goal was to characterize at least 20,000 SNP

  • Industry assisting in the funding of the validation through genotyping cost


Snp project outcomes
SNP Project Outcomes Heritability

  • Parentage verification & traceability panels

  • Enhanced quantitative trait locus mapping

  • Genome-wide selection


Haplotype
Haplotype Heritability

  • From “haploid genotype.” A set of closely linked alleles (genes or DNA polymorphisms) inherited as a unit. Different combinations of polymorphisms are known as haplotypes.


Linkage disequilibrium ld
Linkage disequilibrium (LD) Heritability

  • The non-random association of alleles at two or more loci, not necessarily on the same chromosome.

  • It is not the same as linkage, which describes the association of two or more loci on a chromosome with limited recombination between them.

  • LD describes a situation in which some combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies.


Ld example
LD - Example Heritability


Ld example bta14
LD Example – BTA14 Heritability

Holstein

DGAT1

TG

Limousin


So what
So What?! Heritability

  • Estimate effect of each block

  • All intervals estimated simultaneously

  • Based on the concept proposed by Meuwissen, Hayes, and Goddard (Genetics, 2001)


Whole genome selection
Whole Genome Selection Heritability

  • Fit haplotype block into a statistical model:

Effect

A

B

C

D

E

F

G

H

I

J

K

L

M

1

1

1

1

1

1

1

1

1

1

1

1

1

1

Levels

2

2

2

2

2

2

2

2

2

2

2

2

2

2

3

3

3

3

3

3

3

3

3

3

4

4

4

4


Genome enhanced pbv
Genome Enhanced PBV Heritability


So what does this mean
So What Does This Mean? Heritability

  • Animals can be genotyped at birth

  • GEPBV available at birth for many traits

    • Even those not typically recorded (eg, semen quality)

  • Accuracy is predicted to be similar to progeny test evaluation

  • Generation intervals can be reduced

  • Costs of progeny testing can be decreased

  • Our group is conducting a pilot study

  • The future is almost here!


Parentage verification and discovery
Parentage Verification and Discovery Heritability

  • Genotype a LARGE number of animals

    • Variety of herd types

      • Size

      • Housing

      • Registry status

    • Large number of SNP (200-400)

    • Acquire DNA?

  • Proof of concept that it can be done computationally

  • Characterize ID errors

  • Develop validated panel of SNP


ad