Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis) - PowerPoint PPT Presentation

Evolutionary genomics of mycobacterial pathogens 2 on the origin of tuberculosis l.jpg
Download
1 / 39

  • 241 Views
  • Updated On :
  • Presentation posted in: Pets / Animals

Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis). Stewart Cole. M. bovis. M. tuberculosis. Proposed origin. M. tuberculosis derived from M. bovis. Or was it?.

Related searches for Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis)

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.

Download Presentation

Evolutionary genomics of mycobacterial pathogens - 2 (On the origin of tuberculosis)

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Evolutionary genomics of mycobacterial pathogens 2 on the origin of tuberculosis l.jpg

Evolutionary genomics of mycobacterial pathogens - 2(On the origin oftuberculosis)

Stewart Cole


Slide2 l.jpg

M. bovis

M. tuberculosis

Proposed origin

M. tuberculosis derived from M. bovis

Or was it?


Recent evolution of tb bacilli l.jpg

Proc. Natl. Acad. Sci. USAVol. 94, pp. 9869-74, September 1997GeneticsRestricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global disseminationS. Sreevatsan, X. Pan, K.E. Stockbauer, N.D. Connell, B.N. Kreiswirth, T.S. Whittam AND J.M. MusserSection of Molecular Pathobiology, Department of Pathology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA.Communicated by B.R. Bloom, Albert Einstein College of Medicine, Bronx, NY, July 4, 1997 (received for review May 6, 1997)

Recent evolution of TB bacilli

ABSTRACTOne-third of humans are infected with Mycobacterium tuberculosis, the causative agent of tuberculosis. Sequence analysis of two megabases in 26 structural genes or loci in strains recovered globally discovered a striking reduction of silent nucleotide substitutions compared with other human bacterial pathogens. The lack of neutral mutations in structural genes indicates that M. tuberculosis is evolutionarily young and has recently spread globally. Species diversity is largely caused by rapidly evolving insertion sequences, means that mobile element movement is a fundamental process generating genomic variation in this pathogen. Three genetic groups of M. tuberculosis were identified based on two polymorphisms that occur at high frequency in the genes encoding catalase-peroxidase and the A subunit of gyrase. Group 1 organisms are evolutionarily old and allied with M. bovis, the cause of bovine tuberculosis. A subset of several distinct insertion sequence IS6110 subtypes of this genetic group have IS6110 integrated at the identical chromosomal insertion site, located between dnaA and dnaN in the region containing the origin of replication. Remarkably, study of approximately 6,000 isolates from patients in Houston and the New York City area discovered that 47 of 48 relatively large case clusters were caused by genotypic group 1 and 2 but not group 3 organisms. The observation that the newly emergent group 3 organisms are associated with sporadic rather than clustered cases suggests that the pathogen is evolving toward a state of reduced transmissability or virulence.


Slide4 l.jpg

Genomics of tubercle bacilli

M. tuberculosis complex

M. microti

M. tuberculosis

M. africanum

M. bovis

M. bovis BCG

M. canettii

H37Rv

CDC1551

K- strain

Shotgun

Shotgun

Shotgun

finished

AF2122/97

BCG-Pasteur

4.32 Mb

4.31Mb

4.41 Mb

Finished

In progress


Slide5 l.jpg

Genome of M. tuberculosis

4,000 genes

40%

orphans

Maps of

other spp.

nearly identical

Cole et al. (1998)

Nature 393: 537-544


Sources of genetic diversity l.jpg

Sources of genetic diversity

PZA-R

  • Point mutations or SNP

  • InDels

  • Insertions: IS, gene dup, HT,

    replication errors

  • Deletions: RecA, IS-mediated,

    replication errors

  • Translocations

IS6110, BCG

Common, RD

None to date


Evolutionary genomics of tb bacilli l.jpg

Evolutionary Genomics of TB Bacilli


Comparative genomic statistics l.jpg

Comparative genomic statistics

InDels drive plasticity

TbD1: Major region of difference between Mt & Mb

Garnier et al. (2003) PNAS 100:7877


Tbd1 truncates mmpl6 l.jpg

TbD1 truncates MmpL6

∆ M. tuberculosis

Might affect

lipid/glycolipid

export


Slide10 l.jpg

cobL

Rv2073c

Rv2074

Rv2075c

M. tuberculosis

AAATTACTGTGGCCCTGCGCAA....

..TTGGTGGCACGCCGGGCCGG

AAATTACTGTGGCCCACGCCGGGCCGG

M. africanum

M. microti

M. bovis

BCG

RD9 - an ancient deletion

Cannot be due

to insertion


Slide11 l.jpg

RvD2 - a recent deletion

M. bovis

Rv1758

RvD2-ORF2

RvD2-ORF3

plcD

RvD2-ORF1

M. tuberculosis

H37Ra

IR

Rv1758 ’

RvD2-ORF2

IR

RvD2-ORF3

Rv1758 ’

IS6110

IS6110

IS6110

plcD ’

plcD’

RvD2-ORF1

IS6110

IR

IR

Rv1758 ’

D

AGC

GAG

Rv1758 ’

Less

informative

M. tuberculosis

H37Rv

IR

IS6110

IS6110

plcD ’

IR

GAG

AGC


Slide12 l.jpg

RD9 is

here!

RD regions in M. tb complex


Slide13 l.jpg

RD 9

RD 7

RD 8

RD 10

RD 9

RD 9

RD 7

RD 8

RD10

RD 4

RD 5

RD12

RD13

RD3 (F Rv1)

RD 5’

RD3 (F Rv1)

RD distribution in M. tbc

M. bov.

M. mic.

M. can.

M. tub.

M. afri.

BCG

TbD1

RD 12’

RD 9

RD 7

RD 8

RD10

RD 4

RD 5

RD12

RD13

RD 1

RD 2

RD11 (F Rv2)

RD3 (F Rv1)

RD11 (F Rv2)


Slide14 l.jpg

Evolutionary scenario

RDcan

M. canettii

Numerous sequence

polymorphisms

“ancestral”

TbD 1

RD 9

Common ancestor of the

M. tuberculosis complex

M. tuberculosis

“modern”

katG 463 CTGCGG

gyrA95AGCACC

RD 7

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal-isol.

oxyR 285 GA

RD 12

oryx-isol.

RD 13

Brosch et al.2002

Proc Natl Acad Sci U S A.

99:3684-9.

goat-isol.

pncA 57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

RD 14

BCG Pasteur


Slide15 l.jpg

Rapid ID of TB bacilli

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9+

gyrA 95AGCACC

RD 7

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal

oxyR 285 GA

RD 12

oryx

RD 13

goat

pncA57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

RD 14

BCG Pasteur


Slide16 l.jpg

RDcan

M. canettii

“ancestral”

TbD 1

eg. Beijing cluster

RD 9

“modern”

katG 463 CTGCGG

eg. Haarlem cluster

M. tub.

RD9+

gyrA 95AGCACC

eg. H37Rv

RD 7

RD 8

TbD1-

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal

oxyR n285 GA

RD 12

oryx

RD 13

pncAc57CACGAC

goat

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

RD 14

BCG Pasteur

Rapid ID of TB bacilli


Slide17 l.jpg

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9-

gyrA 95AGCACC

RD 7

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal-isolates

oxyR n285 GA

RD 12

oryx-isolates

RD 13

goat-isolates

pncAc57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

BCG Pasteur

RD 14

Rapid ID of TB bacilli


Slide18 l.jpg

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9-

gyrA 95AGCACC

RD 7

mmpL6 551 AAG

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal-isolates

oxyR n285 GA

RD 12

oryx-isolates

RD 13

goat-isolates

pncA 57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

BCG Pasteur

RD 14

Rapid ID of TB bacilli


Slide19 l.jpg

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9-

gyrA 95AGCACC

RD 7

RD 8

RD4-

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal

oxyR n285 GA

RD 12

oryx

RD 13

goat

pncA 57CACGAC

RD 4

M. bovis

“classical”

RD 1

BCG Tokyo

RD 2

RD 14

BCG Pasteur

Rapid ID of TB bacilli


Slide20 l.jpg

RDcan

M. canettii

“ancestral”

TbD 1

RD 9

M. tub.

katG 463 CTGCGG

“modern”

RD9-

gyrA 95AGCACC

RD 7

RD1-

RD 8

RD 10

M. africanum

mmpL6 551AACAAG

RDmic

M. microti

RDseal

seal

oxyR n285 GA

RD 12

oryx

RD 13

goat

pncA 57CACGAC

RD 4

M. bovis

“classical”

RD 1

RD 2

RD 14

BCG

Rapid ID of TB bacilli


Slide21 l.jpg

Evolution of the M. tb complex

M. bovis

X

M. tuberculosis


Slide22 l.jpg

Evolution of the M. tb complex

M. bovis

M. tuberculosis

Progenitor bacillus


Has m tb evolved since l.jpg

Has M. tb evolved since?

Different approaches to population genetics

All based on genomics


Slide24 l.jpg

Mycobacterium canettii issmooth

M. canettii

M. tuberculosis


Slide25 l.jpg

M. prototuberculosis

Split decomposition analysis, SNP data

MTBC

(worldwide)

M. canettii

Smooth tubercle

bacilli

(Djibouti, East Africa)


Slide26 l.jpg

LSP (RD) typing

Gagneux et al. (2006) Variable host-pathogen compatibility in M. tuberculosis. Proc Natl Acad Sci

U S A; 103: 2869-2873.


Slide27 l.jpg

SNP typing - 1

Baker et al. (2004)

Silent nucleotide polymorphisms and

a phylogeny for Mycobacterium tuberculosis.

Emerg Infect Dis 2004; 10: 1568-77.

Examined 37 sSNPs

in 225 isolates


Slide28 l.jpg

SNP typing - 2

36 sSNPs

in 5069 isolates

Gutacker et al. (2006) Single-nucleotide polymorphism-based population genetic analysis of Mycobacterium tuberculosis strains from 4 geographic sites. J Infect Dis; 193: 121-128.


Slide29 l.jpg

SNP typing - 3

Studied 159 sSNPs

in 219 isolates


Slide30 l.jpg

Global distribution

Red Euro-American

Green W-African 1

Brown W-African 2

Yellow Indo-Oceanic

Purple EA-Indian

Blue East Asian

Blue is most

worrying


The beijing family l.jpg

The Beijing family

Appears to be more virulent, more transmissible & associated with MDR

TRENDS in Microbiology

Vol.10 No.1 January 2002

45-52


Beijing phylogeny l.jpg

Beijing phylogeny

Marmiesse et al. (2004)

Microbiology 150: 483 - 496


A new lipid pgl in beijing l.jpg

A new lipid - PGL - in Beijing

Reed et al. (2004) Nature 431: 84-87


Effect of pgl on virulence l.jpg

Immunocompetent mice, aerosol infection

Effect of PGL on virulence

Reed et al. (2004) Nature 431: 84-87


Immunologic effects of pgl l.jpg

Immunologic effects of PGL

Reed et al. (2004) Nature 431: 84-87


Further immunologic effects l.jpg

Further immunologic effects

Single sugar accounts for difference

Reed et al. (2004) Nature 431: 84-87


Pgl impacts on phenotype l.jpg

PGL impacts on phenotype

  • Increases lethality greatly but not bacterial load

  • Down-regulates pro-inflammatory response in dose-dependent manner

  • Represses TNF-alpha, IL-6 & IL-12 production

  • May contribute to increased transmission

Reed et al. (2004) Nature 431: 84-87


Summary l.jpg

Summary

  • M. tuberculosis complex tightly knit but differences

    in host range

  • M. tuberculosis not descended from M. bovis

    but possibly from M. prototuberculosis

  • Species became host adapted. 4-5 major M.tb groups

  • Hypervirulent variants emerge and replace

    existing clones


Slide39 l.jpg

With the participation of...

Institut Pasteur

R. Brosch

S. Brisse

M-C. Gutierrez

T. Garnier

N. Honoré

M. Marmiesse

V. Vincent

WT Sanger Institute

B.G. Barrell

J. Parkhill

M-A. Rajandream

NIH

NIAID

ILEP

Central Veterinary Lab.

R.G. Hewinson

S.V. Gordon


  • Login