Stability and Compensated Pathogenic Deviations - PowerPoint PPT Presentation

Stability and compensated pathogenic deviations l.jpg
Download
1 / 36

  • 244 Views
  • Uploaded on
  • Presentation posted in: Pets / Animals

Stability and Compensated Pathogenic Deviations. Fyodor A. Kondrashov Section of Ecology, Animal Behavior and Evolution University of California at San Diego. How can we make an elephant from scratch?. giraffe. elephant. TACG. ATGC. AT CG. Common ancestor. giraffe. ATGC. ATG G.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.

Download Presentation

Stability and Compensated Pathogenic Deviations

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Stability and compensated pathogenic deviations l.jpg

Stability and Compensated Pathogenic Deviations

Fyodor A. Kondrashov

Section of Ecology, Animal Behavior and Evolution

University of California at San Diego


Slide2 l.jpg

How can we make an elephant from scratch?


Slide3 l.jpg

giraffe

elephant

TACG

ATGC

ATCG

Common ancestor


Slide4 l.jpg

giraffe

ATGC

ATGG

ATCC

TTGC

AAGC

AAGG

ATCG

TTGG

TAGC

TTCC

AACC

TTCG

TAGG

TACC

AACG

Common ancestor

elephant

TACG


Slide5 l.jpg

Ideal World Breeding

Real World Breeding

x

x


Slide6 l.jpg

Fitness

Genotype

Genotype


Slide7 l.jpg

MITOMAPA human mitochondrial genome database

A compendium of polymorphisms and mutations of the human mitochondrial DNA

Are human pathogenic mutations also pathogenic to closely related species?


Slide9 l.jpg

Methods.

Genbank

22 tRNA multiple alignments with 106 mammals and with marked CPDs

ENTREZ

Phylogeny information

Complete mammalian mitochondrial genomes

FEDYA, ANDY,

TEXTPAD, mfold

EYES and PERL

Pathogenic mutations

Synteny preserved in most mammals (except marsupials)

CLUSTAWL

Multiple alignment

Secondary structure info


Slide10 l.jpg

A multiple alignment of primate orthologs for Glycine (G) tRNA.

humanactcttttagtataaat--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta

chimpanzeeactcttttagtataaGt--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta

pygmy chimpanzeeactcttttagtataaGc--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta

gorillaactcttttagtataatt--agtaccgttaacttccaattaaccagttttggt-agtacccaaaaaagagta

orangutanactcttttagtataaGc--agtaccgttaacttccaattaaccagttttgac-aacactcaaaaaagagta

Sumatran orangutanactcttttagtataaac--agtaccgttaacttccaattaactagttttgac-aacGcccaaaaaagagta

hamadryas baboonactcttttagtataatt--agtacaAttgacttccaatcaatcagctttgac-aatattcaaaaaagagta

Barbary apeactcttttagtataacc--agtacaAttgacttccaatcaatcagttttgac-aacattcaaaaaagagta

common gibbonactcttttagtataaac--agtactgttaacttccaattaaccagcttcgat-aacGctcgaaaaagagta

capuchin attctcttagtataaac--agtacaAttgacttccaattaataggccttgat-aa-acccaagagagaata

ring-tailed lemurattcttttagtatcgacccaatacaAttgacttccaattaattaacttcggtgaa-aaccggaaaagaata

slow lorisgctcttttagtacaact--agtacaAttgacttccaatcaataggatttggtaaataaccaaaagagagca

western tarsiergttcctttagtatcaatt-agtacaAttgacttccaatcaattagccctagtacaattctaggaaggaaca

. * . * *


Slide11 l.jpg

A multiple alignment of selected mammalian orthologs for Luicine UUR (L1).

humangttaagatggcagagcccggtaatcgcataaaacttaaaactttacagt-cagaggttcaattcctcttcttaaca

western tarsiergttaagatggcagagcccggCaattgcataaaacttaaaactttattat-cagaggttcaactcctcttcttaaca

northern tree shrewgttaaggtggcagagcccggtcattgcctaaaacttaagattttaAgta-cagaagttcaaatcctctccttaaca

European haregttaaggtggcagagcccggCaattgcataaaacttaaaactttataat-cagaggttcaactcctctccttaaca

Egyptian jerboagctaagatggcagagcccggtaattgcaCaagacttaaaccCttgAatc-cagaggttcaactcctcttcttaGca

Eurasian red squirrelattaagatggcagagcccggcaattgcataagatttaaaacCttactat-cagaggttcaactcctcttcttaaTa

Madagascar hedgehogattaagatggcagagcc-ggtaattgcaCaagacttaaaccCttgctgt-cagaggttcaatCcctcttcttaaTa

little red flying foxgttaggatggcagagcccggCaattgcataaaacttaagcttttataat-cagaggttcaactcctcttcctaaca

Japanese house batgttaaagtggcagagaccggtaattgcataaaacttaagattttagagc-cagaggttcaactcctctctttaaTa

polar beargttagggtggcagagcccggtGattgcataaaacttaaacctttatact-cagaggttcaaatcctctccctaaca

Atlantic walrusgttagggtg-cagagcccggtaattgcataaaacttaaacttttacccc-cagaggttcaactcctctccctaaTa

greater Indian rhinogttaggatggcagagcccggtaactgcataaaacttaaacctttataac-cagaggttcaactcctcttcctaaca

narwhalgttgggatggcagagtacggCaattgcataaaacttaaacctttatacc-cagaggttcaaatcctcttcccaaca

Indus River dolphingttgaggtggcagagtccggCaattgTataaaacttaaacttttacact-cagaggttcaaatcctctccccaaca

pigattagggtggcagagaccggtaattgcgtaaaacttaaacctttattac-cagaggttcaactcctctccctaaTa

nine-banded armadillogttaagatggcagagacaggtaattgcataagacttaaacctttattac-cagaggttcaaatcctcttcttaaca

aardvarkgttaaggtggcagagcccggtaattgcataaaacttaagcttttacaac-cagaggttcaattcctctccttaaca

Asiatic elephantgttaagatagcaaaaattggtcactgcataaaacttaagcttttactca-cGgaggttcaactcctcttcttaaca

African elephantgttaagatagcaaaaactggtcactgcataaaacttaagcttttactca-cGgaggttcaactcctcttcttaaca

wallarooattaaggtggcagagcc-ggCaattgcataaaacttaaacctttataat-cagaggttcaaatcctctccttaaTa

common wombatattaaggtggcagagca-ggtaattgcataaaacttaagcctttacaac-cagaggttcaaaCcctctccttaaTa

platypusattaaggtgacagagaccggtaattgTgtaaaacttaagcttttatagt-cagaggttcaaatcctctccttaaTa

Australian echidnaattaaggtgacagagaccggCaattgTgtaaaacttaagcttttataat-cagaggttcaaatcctctccttaaTa

. .**. . * * . . * . * * . * **


Slide12 l.jpg

Compensated Pathogenic Deviation (CPD)

Molecular event (substitution or other) that is present in a wild-type in one species and is pathogenic in another species.

Compensatory Deviation

Molecular event (substitution or other) that negates the deleterious effect of a Pathogenic Mutation


Slide13 l.jpg

Homo sapiens tRNAAsn

3’

G

5’

U

A

A

U

Acceptorstem

G

C

A

U

U

G

U

G

G

G

U

U

A

U

A

C

C

C

A

A

U

G

A

U

G

U

G

G

G

U

A

C

C

G

G

U

U

U

A

U

G

G

G

U

U

TYC-stem/loop

A

U

U

G

G

U

D-stem/loop

C

G

U

A

U

A

Anticodonstem/loop

A

U

G

C

C

A

U

A

G

U

U

Can we say anything about a molecular or structural basis of compensations?


Slide14 l.jpg

Pan troglodytes(chimpanzee) tRNAAsn

3’

G

5’

U

A

A

U

Acceptorstem

G

C

A

U

G

U

A

U

A

G

G

G

U

U

A

U

A

C

C

C

A

A

U

G

A

U

G

U

G

G

G

U

A

C

C

G

G

U

U

U

A

U

G

G

G

U

U

TYC-stem/loop

A

U

U

G

G

U

D-stem/loop

U

A

C

U

A

G

U

A

A

U

Anticodonstem/loop

G

C

C

A

U

A

G

U

U

Figure 2a


Slide15 l.jpg

Cynocephalus variegatus

(Malayan flying lemur) tRNALys

3’

A

Acceptorstem

5’

C

G

A

U

G

C

U

A

C

A

U

G

C

U

A

U

U

CA

C

G

C

A

D-stem/loop

A

C

C

C

U

U

C

A

A

C

A

U

U

G

G

A

A

G

G

U

C

G

A

C

U

A

U

C

A

A

C

G

A

G

A

C

A

A

U

A

A

TYC-stem/loop

U

U

G

A

U

A

U

A

A

U

Anticodonstem/loop

A

U

C

G

C

A

U

A

U

U

U

Figure 2b


Slide16 l.jpg

human

CG

Common ancestor

CA

UG

UA

chimp


Slide17 l.jpg

Ceratotherium simum

(white rhinoceros) tRNATrp

3’

G

5’

A

U

Acceptorstem

G

C

G

C

U

A

A

U

A

U

U

A

TYC-stem/loop

U

A

A

C

A

U

U

U

C

A

U

A

A

A

C

U

U

G

G

A

A

G

U

A

A

A

C

C

U

C

G

A

C

C

U

C

A

C

G

G

UA

A

A

D-stem/loop

A

A

U

C

G

C

A

G

C

Anticodonstem/loop

G

A

C

C

G

C

A

U

A

U

A

C

Figure 2c


Slide18 l.jpg

Ursus maritimus(polar bear) tRNASer(UCN)

3’

A

5’

G

U

A

U

A

U

G

C

A

U

Acceptorstem

A

G

U

U

A

U

G

C

C

U

A

U

G

A

C

U

U

C

C

A

G

G

U

A

U

A

G

A

G

G

G

C

C

G

G

U

U

A

U

U

A

U

G

G

G

C

U

TYC-stem/loop

U

A

C

C

U

G

C

U

A

U

G

D-stem/loop

C

G

U

A

G

U

A

Anticodonstem/loop

G

C

G

C

C

A

U

A

U

A

G

Figure 2d


Slide19 l.jpg

Spalax ehrenbergi(Ehrenberg's mole-rat) tRNAIle

3’

A

5’

A

U

G

C

Acceptorstem

A

U

A

U

TYC-stem/loop

A

U

A

C

G

U

A

U

A

C

G

U

U

C

U

C

C

A

U

G

A

A

G

A

G

G

A

G

C

C

U

C

U

U

U

A

A

A

G

C

A

G

A

A

UU

C

A

G

A

U

A

U

A

D-stem/loop

A

U

G

A

U

Anticodonstem/loop

C

G

U

A

U

G

U

A

G

U

A

Figure 2e


Slide20 l.jpg

Tamandua tetradactyla

(southern tamandua) tRNAIle

3’

A

5’

A

U

G

C

A

U

Acceptorstem

A

U

TYC-stem/loop

A

U

U

A

C

A

A

U

G

C

U

A

U

C

U

C

C

U

U

C

G

A

A

G

A

G

G

A

G

C

C

U

C

U

C

A

U

A

A

A

G

A

G

G

A

U

A

U

C

C

A

D-stem/loop

U

A

A

A

A

U

U

G

U

A

A

U

Anticodonstem/loop

C

G

U

A

U

G

U

A

G

U

A


Slide21 l.jpg

Hyperoodon ampullatus

(northern bottlenose whale) tRNALeu(UUR)

3’

A

5’

G

C

Acceptorstem

U

A

U

A

U

G

C

A

G

U

A

U

G

C

D-stem/loop

G

C

A

C

U

A

U

U

A

U

C

U

C

C

C

G

U

A

C

G

A

G

A

C

G

A

G

A

G

G

U

C

U

U

C

G

C

U

G

U

C

TYC-stem/loop

U

G

A

C

A

C

G

A

C

C

U

A

U

C

U

A

A

U

Anticodonstem/loop

A

U

A

U

C

A

U

C

A

C

U

A

A

U

A

Figure 2f


Slide22 l.jpg

Tachyglossus aculeatus

(Australian echidna) tRNALeu(UUR)

3’

A

5’

A

U

C

G

U

A

U

A

Acceptorstem

A

U

A

U

U

G

C

D-stem/loop

A

G

C

U

C

A

U

G

A

U

C

U

C

C

U

G

A

A

A

C

G

A

G

A

G

G

C

G

A

C

A

C

U

U

C

G

TYC-stem/loop

U

U

U

G

U

G

A

A

C

A

G

A

C

C

G

U

U

U

A

A

A

U

C

A

U

Anticodonstem/loop

A

U

C

A

U

C

C

A

U

G

A

U

A

A


Slide23 l.jpg

Oryctolagus cuniculus

(rabbit) tRNACys

3’

U

5’

A

U

G

C

C

G

U

C

G

C

G

A

C

C

U

G

G

C

A

C

A

A

C

G

U

C

U

A

G

G

U

C

G

C

A

G

C

G

G

U

G

A

U

U

A

C

A

C

A

U

U

A

A

A

G

A

U

U

A

U

G

U

A

G

C

A

U

A

U

U

A

U

A

G

A

C


Slide24 l.jpg

Canis familiaris

(dog) tRNALeu(UUR)

3’

A

5’

G

C

U

A

Acceptorstem

U

A

A

U

G

C

U

A

G

C

A

U

G

C

A

G

U

U

G

C

A

U

C

U

C

C

G

C

U

A

G

A

C

G

C

A

G

A

G

G

C

U

U

G

C

C

U

G

C

TYC-stem/loop

U

G

A

G

U

A

A

C

U

U

C

U

A

A

G

D-stem/loop

A

U

A

A

U

Anticodonstem/loop

A

U

A

C

A

C

C

U

A

U

A

A

Wittenhagen, L.M. & Kelley, S.O.,

Nat. Struct. Biol. (2002) and

Trends Biochem. Sci. (2003),


Slide27 l.jpg

  • So what?

  • This can be used to study the limits of tRNA stability in evolution

  • DM incompatibilities are intergenic, not expected to be revealed in F1 generation

  • Molecular basis of compensatory evolution is much more varied than has been appreciated

  • Fitness ridges of tRNAs are very epistatic such that 50% of all substitutions are compensatory

  • Fixation of CPD and/or Compensatory mutations occurs under positive selection


Slide28 l.jpg

Polymeropoulos MH, et al., Science, 1997


Slide30 l.jpg

Usual model of fitness: fitness potential

f(p) = fitness, where p is the fitness potential such that

p = c1a + c2b … + cnn

where cnn is the total fitness contribution of allele (mutation) n

This model cannot describe the evolutionary trajectory of CPDs.


Slide31 l.jpg

Fitness in colour:

Low fitness Medium fitness High fitness

Neutral case:

(1,0)

(1,1)

CPD

(0,0)

(0,1)

Compensatory


Slide32 l.jpg

Other types of CPD fitness surfaces

(1,0)

(1,1)

(1,0)

(1,1)

CPD

CPD

(0,0)

(0,1)

(0,0)

(0,1)

Compensatory

Compensatory

(1,0)

(1,1)

(1,0)

(1,1)

CPD

CPD

(0,0)

(0,1)

(0,0)

(0,1)

Compensatory

Compensatory


Slide33 l.jpg

Figure from DePristo et al. Nat. Genet. Rev. 2005


Slide34 l.jpg

Fitness:

From DePristo et al. Nat. Genet. Rev. 2005


Slide35 l.jpg

Fitness

Genotype

Genotype


Slide36 l.jpg

Acknowledgements

Alexey KondrashovNCBI, NIH

Shamil SunyaevHarvard Medical School

Andrew KernUniversity of California, Santa Cruz

Financial Support

National Science Foundation Graduate Research Fellowship


  • Login