Stability and compensated pathogenic deviations
Download
1 / 36

Stability and Compensated Pathogenic Deviations - PowerPoint PPT Presentation


  • 260 Views
  • Uploaded on

Stability and Compensated Pathogenic Deviations. Fyodor A. Kondrashov Section of Ecology, Animal Behavior and Evolution University of California at San Diego. How can we make an elephant from scratch?. giraffe. elephant. TACG. ATGC. AT CG. Common ancestor. giraffe. ATGC. ATG G.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Stability and Compensated Pathogenic Deviations' - Patman


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Stability and compensated pathogenic deviations l.jpg
Stability and Compensated Pathogenic Deviations

Fyodor A. Kondrashov

Section of Ecology, Animal Behavior and Evolution

University of California at San Diego



Slide3 l.jpg

giraffe

elephant

TACG

ATGC

ATCG

Common ancestor


Slide4 l.jpg

giraffe

ATGC

ATGG

ATCC

TTGC

AAGC

AAGG

ATCG

TTGG

TAGC

TTCC

AACC

TTCG

TAGG

TACC

AACG

Common ancestor

elephant

TACG


Slide5 l.jpg

Ideal World Breeding

Real World Breeding

x

x


Slide6 l.jpg

Fitness

Genotype

Genotype


Slide7 l.jpg

MITOMAPA human mitochondrial genome database

A compendium of polymorphisms and mutations of the human mitochondrial DNA

Are human pathogenic mutations also pathogenic to closely related species?


Slide9 l.jpg

Methods.

Genbank

22 tRNA multiple alignments with 106 mammals and with marked CPDs

ENTREZ

Phylogeny information

Complete mammalian mitochondrial genomes

FEDYA, ANDY,

TEXTPAD, mfold

EYES and PERL

Pathogenic mutations

Synteny preserved in most mammals (except marsupials)

CLUSTAWL

Multiple alignment

Secondary structure info


Slide10 l.jpg

A multiple alignment of primate orthologs for Glycine (G) tRNA.

human actcttttagtataaat--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta

chimpanzee actcttttagtataaGt--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta

pygmy chimpanzee actcttttagtataaGc--agtaccgttaacttccaattaactagttttgac-aacattcaaaaaagagta

gorilla actcttttagtataatt--agtaccgttaacttccaattaaccagttttggt-agtacccaaaaaagagta

orangutan actcttttagtataaGc--agtaccgttaacttccaattaaccagttttgac-aacactcaaaaaagagta

Sumatran orangutan actcttttagtataaac--agtaccgttaacttccaattaactagttttgac-aacGcccaaaaaagagta

hamadryas baboon actcttttagtataatt--agtacaAttgacttccaatcaatcagctttgac-aatattcaaaaaagagta

Barbary ape actcttttagtataacc--agtacaAttgacttccaatcaatcagttttgac-aacattcaaaaaagagta

common gibbon actcttttagtataaac--agtactgttaacttccaattaaccagcttcgat-aacGctcgaaaaagagta

capuchin attctcttagtataaac--agtacaAttgacttccaattaataggccttgat-aa-acccaagagagaata

ring-tailed lemur attcttttagtatcgacccaatacaAttgacttccaattaattaacttcggtgaa-aaccggaaaagaata

slow loris gctcttttagtacaact--agtacaAttgacttccaatcaataggatttggtaaataaccaaaagagagca

western tarsier gttcctttagtatcaatt-agtacaAttgacttccaatcaattagccctagtacaattctaggaaggaaca

. * . * *


Slide11 l.jpg

A multiple alignment of selected mammalian orthologs for Luicine UUR (L1).

human gttaagatggcagagcccggtaatcgcataaaacttaaaactttacagt-cagaggttcaattcctcttcttaaca

western tarsier gttaagatggcagagcccggCaattgcataaaacttaaaactttattat-cagaggttcaactcctcttcttaaca

northern tree shrew gttaaggtggcagagcccggtcattgcctaaaacttaagattttaAgta-cagaagttcaaatcctctccttaaca

European hare gttaaggtggcagagcccggCaattgcataaaacttaaaactttataat-cagaggttcaactcctctccttaaca

Egyptian jerboa gctaagatggcagagcccggtaattgcaCaagacttaaaccCttgAatc-cagaggttcaactcctcttcttaGca

Eurasian red squirrel attaagatggcagagcccggcaattgcataagatttaaaacCttactat-cagaggttcaactcctcttcttaaTa

Madagascar hedgehog attaagatggcagagcc-ggtaattgcaCaagacttaaaccCttgctgt-cagaggttcaatCcctcttcttaaTa

little red flying fox gttaggatggcagagcccggCaattgcataaaacttaagcttttataat-cagaggttcaactcctcttcctaaca

Japanese house bat gttaaagtggcagagaccggtaattgcataaaacttaagattttagagc-cagaggttcaactcctctctttaaTa

polar bear gttagggtggcagagcccggtGattgcataaaacttaaacctttatact-cagaggttcaaatcctctccctaaca

Atlantic walrus gttagggtg-cagagcccggtaattgcataaaacttaaacttttacccc-cagaggttcaactcctctccctaaTa

greater Indian rhino gttaggatggcagagcccggtaactgcataaaacttaaacctttataac-cagaggttcaactcctcttcctaaca

narwhal gttgggatggcagagtacggCaattgcataaaacttaaacctttatacc-cagaggttcaaatcctcttcccaaca

Indus River dolphin gttgaggtggcagagtccggCaattgTataaaacttaaacttttacact-cagaggttcaaatcctctccccaaca

pig attagggtggcagagaccggtaattgcgtaaaacttaaacctttattac-cagaggttcaactcctctccctaaTa

nine-banded armadillo gttaagatggcagagacaggtaattgcataagacttaaacctttattac-cagaggttcaaatcctcttcttaaca

aardvark gttaaggtggcagagcccggtaattgcataaaacttaagcttttacaac-cagaggttcaattcctctccttaaca

Asiatic elephant gttaagatagcaaaaattggtcactgcataaaacttaagcttttactca-cGgaggttcaactcctcttcttaaca

African elephant gttaagatagcaaaaactggtcactgcataaaacttaagcttttactca-cGgaggttcaactcctcttcttaaca

wallaroo attaaggtggcagagcc-ggCaattgcataaaacttaaacctttataat-cagaggttcaaatcctctccttaaTa

common wombat attaaggtggcagagca-ggtaattgcataaaacttaagcctttacaac-cagaggttcaaaCcctctccttaaTa

platypus attaaggtgacagagaccggtaattgTgtaaaacttaagcttttatagt-cagaggttcaaatcctctccttaaTa

Australian echidna attaaggtgacagagaccggCaattgTgtaaaacttaagcttttataat-cagaggttcaaatcctctccttaaTa

. .**. . * * . . * . * * . * **


Slide12 l.jpg

Compensated Pathogenic Deviation ( Luicine UUR (L1). CPD)

Molecular event (substitution or other) that is present in a wild-type in one species and is pathogenic in another species.

Compensatory Deviation

Molecular event (substitution or other) that negates the deleterious effect of a Pathogenic Mutation


Slide13 l.jpg

Homo sapiens tRNA Luicine UUR (L1). Asn

3’

G

5’

U

A

A

U

Acceptorstem

G

C

A

U

U

G

U

G

G

G

U

U

A

U

A

C

C

C

A

A

U

G

A

U

G

U

G

G

G

U

A

C

C

G

G

U

U

U

A

U

G

G

G

U

U

TYC-stem/loop

A

U

U

G

G

U

D-stem/loop

C

G

U

A

U

A

Anticodonstem/loop

A

U

G

C

C

A

U

A

G

U

U

Can we say anything about a molecular or structural basis of compensations?


Slide14 l.jpg

Pan troglodytes Luicine UUR (L1). (chimpanzee) tRNAAsn

3’

G

5’

U

A

A

U

Acceptorstem

G

C

A

U

G

U

A

U

A

G

G

G

U

U

A

U

A

C

C

C

A

A

U

G

A

U

G

U

G

G

G

U

A

C

C

G

G

U

U

U

A

U

G

G

G

U

U

TYC-stem/loop

A

U

U

G

G

U

D-stem/loop

U

A

C

U

A

G

U

A

A

U

Anticodonstem/loop

G

C

C

A

U

A

G

U

U

Figure 2a


Slide15 l.jpg

Cynocephalus variegatus Luicine UUR (L1).

(Malayan flying lemur) tRNALys

3’

A

Acceptorstem

5’

C

G

A

U

G

C

U

A

C

A

U

G

C

U

A

U

U

CA

C

G

C

A

D-stem/loop

A

C

C

C

U

U

C

A

A

C

A

U

U

G

G

A

A

G

G

U

C

G

A

C

U

A

U

C

A

A

C

G

A

G

A

C

A

A

U

A

A

TYC-stem/loop

U

U

G

A

U

A

U

A

A

U

Anticodonstem/loop

A

U

C

G

C

A

U

A

U

U

U

Figure 2b


Slide16 l.jpg

human Luicine UUR (L1).

CG

Common ancestor

CA

UG

UA

chimp


Slide17 l.jpg

Ceratotherium simum Luicine UUR (L1).

(white rhinoceros) tRNATrp

3’

G

5’

A

U

Acceptorstem

G

C

G

C

U

A

A

U

A

U

U

A

TYC-stem/loop

U

A

A

C

A

U

U

U

C

A

U

A

A

A

C

U

U

G

G

A

A

G

U

A

A

A

C

C

U

C

G

A

C

C

U

C

A

C

G

G

UA

A

A

D-stem/loop

A

A

U

C

G

C

A

G

C

Anticodonstem/loop

G

A

C

C

G

C

A

U

A

U

A

C

Figure 2c


Slide18 l.jpg

Ursus maritimus Luicine UUR (L1). (polar bear) tRNASer(UCN)

3’

A

5’

G

U

A

U

A

U

G

C

A

U

Acceptorstem

A

G

U

U

A

U

G

C

C

U

A

U

G

A

C

U

U

C

C

A

G

G

U

A

U

A

G

A

G

G

G

C

C

G

G

U

U

A

U

U

A

U

G

G

G

C

U

TYC-stem/loop

U

A

C

C

U

G

C

U

A

U

G

D-stem/loop

C

G

U

A

G

U

A

Anticodonstem/loop

G

C

G

C

C

A

U

A

U

A

G

Figure 2d


Slide19 l.jpg

Spalax ehrenbergi Luicine UUR (L1). (Ehrenberg's mole-rat) tRNAIle

3’

A

5’

A

U

G

C

Acceptorstem

A

U

A

U

TYC-stem/loop

A

U

A

C

G

U

A

U

A

C

G

U

U

C

U

C

C

A

U

G

A

A

G

A

G

G

A

G

C

C

U

C

U

U

U

A

A

A

G

C

A

G

A

A

UU

C

A

G

A

U

A

U

A

D-stem/loop

A

U

G

A

U

Anticodonstem/loop

C

G

U

A

U

G

U

A

G

U

A

Figure 2e


Slide20 l.jpg

Tamandua tetradactyla Luicine UUR (L1).

(southern tamandua) tRNAIle

3’

A

5’

A

U

G

C

A

U

Acceptorstem

A

U

TYC-stem/loop

A

U

U

A

C

A

A

U

G

C

U

A

U

C

U

C

C

U

U

C

G

A

A

G

A

G

G

A

G

C

C

U

C

U

C

A

U

A

A

A

G

A

G

G

A

U

A

U

C

C

A

D-stem/loop

U

A

A

A

A

U

U

G

U

A

A

U

Anticodonstem/loop

C

G

U

A

U

G

U

A

G

U

A


Slide21 l.jpg

Hyperoodon ampullatus Luicine UUR (L1).

(northern bottlenose whale) tRNALeu(UUR)

3’

A

5’

G

C

Acceptorstem

U

A

U

A

U

G

C

A

G

U

A

U

G

C

D-stem/loop

G

C

A

C

U

A

U

U

A

U

C

U

C

C

C

G

U

A

C

G

A

G

A

C

G

A

G

A

G

G

U

C

U

U

C

G

C

U

G

U

C

TYC-stem/loop

U

G

A

C

A

C

G

A

C

C

U

A

U

C

U

A

A

U

Anticodonstem/loop

A

U

A

U

C

A

U

C

A

C

U

A

A

U

A

Figure 2f


Slide22 l.jpg

Tachyglossus aculeatus Luicine UUR (L1).

(Australian echidna) tRNALeu(UUR)

3’

A

5’

A

U

C

G

U

A

U

A

Acceptorstem

A

U

A

U

U

G

C

D-stem/loop

A

G

C

U

C

A

U

G

A

U

C

U

C

C

U

G

A

A

A

C

G

A

G

A

G

G

C

G

A

C

A

C

U

U

C

G

TYC-stem/loop

U

U

U

G

U

G

A

A

C

A

G

A

C

C

G

U

U

U

A

A

A

U

C

A

U

Anticodonstem/loop

A

U

C

A

U

C

C

A

U

G

A

U

A

A


Slide23 l.jpg

Oryctolagus cuniculus Luicine UUR (L1).

(rabbit) tRNACys

3’

U

5’

A

U

G

C

C

G

U

C

G

C

G

A

C

C

U

G

G

C

A

C

A

A

C

G

U

C

U

A

G

G

U

C

G

C

A

G

C

G

G

U

G

A

U

U

A

C

A

C

A

U

U

A

A

A

G

A

U

U

A

U

G

U

A

G

C

A

U

A

U

U

A

U

A

G

A

C


Slide24 l.jpg

Canis familiaris Luicine UUR (L1).

(dog) tRNALeu(UUR)

3’

A

5’

G

C

U

A

Acceptorstem

U

A

A

U

G

C

U

A

G

C

A

U

G

C

A

G

U

U

G

C

A

U

C

U

C

C

G

C

U

A

G

A

C

G

C

A

G

A

G

G

C

U

U

G

C

C

U

G

C

TYC-stem/loop

U

G

A

G

U

A

A

C

U

U

C

U

A

A

G

D-stem/loop

A

U

A

A

U

Anticodonstem/loop

A

U

A

C

A

C

C

U

A

U

A

A

Wittenhagen, L.M. & Kelley, S.O.,

Nat. Struct. Biol. (2002) and

Trends Biochem. Sci. (2003),


Slide27 l.jpg

  • So what? Luicine UUR (L1).

  • This can be used to study the limits of tRNA stability in evolution

  • DM incompatibilities are intergenic, not expected to be revealed in F1 generation

  • Molecular basis of compensatory evolution is much more varied than has been appreciated

  • Fitness ridges of tRNAs are very epistatic such that 50% of all substitutions are compensatory

  • Fixation of CPD and/or Compensatory mutations occurs under positive selection


Slide28 l.jpg

Polymeropoulos MH, Luicine UUR (L1). et al., Science, 1997


Slide30 l.jpg

Usual model of fitness: fitness potential Luicine UUR (L1).

f(p) = fitness, where p is the fitness potential such that

p = c1a + c2b … + cnn

where cnn is the total fitness contribution of allele (mutation) n

This model cannot describe the evolutionary trajectory of CPDs.


Slide31 l.jpg

Fitness in colour: Luicine UUR (L1).

Low fitness Medium fitness High fitness

Neutral case:

(1,0)

(1,1)

CPD

(0,0)

(0,1)

Compensatory


Slide32 l.jpg

Other types of CPD fitness surfaces Luicine UUR (L1).

(1,0)

(1,1)

(1,0)

(1,1)

CPD

CPD

(0,0)

(0,1)

(0,0)

(0,1)

Compensatory

Compensatory

(1,0)

(1,1)

(1,0)

(1,1)

CPD

CPD

(0,0)

(0,1)

(0,0)

(0,1)

Compensatory

Compensatory


Slide33 l.jpg

Figure from DePristo Luicine UUR (L1). et al. Nat. Genet. Rev. 2005


Slide34 l.jpg

Fitness: Luicine UUR (L1).

From DePristo et al. Nat. Genet. Rev. 2005


Slide35 l.jpg

Fitness Luicine UUR (L1).

Genotype

Genotype


Slide36 l.jpg

Acknowledgements Luicine UUR (L1).

Alexey Kondrashov NCBI, NIH

Shamil Sunyaev Harvard Medical School

Andrew Kern University of California, Santa Cruz

Financial Support

National Science Foundation Graduate Research Fellowship


ad