multiple alignment - PowerPoint PPT Presentation

  • Updated On :

Pairwise Alignment. The alignment of two sequences (DNA or protein) is a relatively straightforward computational problem. Can be done in a word processorBut how to evaluate the results?A natural job for a computerThe best solution seems to be an approach called Dynamic Programming. . TGCCATAGAGCGTAGTCGTTCCCT <

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about 'multiple alignment' - Olivia

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript