Sorry, some images removed for web posting,
Download
1 / 41

Sorry - PowerPoint PPT Presentation


  • 668 Views
  • Updated On :

Sorry, some images removed for web posting, due to concern about copyrights.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Sorry' - Michelle


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Slide1 l.jpg

Sorry, some images removed for web posting,

due to concern about copyrights.


Slide2 l.jpg

ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCTTGGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAACAAAACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATGCTCATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGCTTGTATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTTATGAAGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACACATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTCACGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATATCATCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCGGTCGTTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCATTATCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGTGAATATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTCCTATTAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGGGACAATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCATGTAATACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTAAATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGTTTTCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTTTGGTTTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCTTTGCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTCAAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGATATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAACAAGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTACCAAAAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGTAGAAATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGGTGTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGCAATTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGTAATATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTGAGGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCTTGGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAACAAAACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATGCTCATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGCTTGTATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTTATGAAGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACACATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTCACGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATATCATCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCGGTCGTTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCATTATCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGTGAATATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTCCTATTAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGGGACAATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCATGTAATACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTAAATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGTTTTCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTTTGGTTTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCTTTGCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTCAAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGATATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAACAAGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTACCAAAAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGTAGAAATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGGTGTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGCAATTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGTAATATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTGAGGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCT

DNA sequencing

What, When, Why?

How?

Who and Where?

DNA detective


Slide3 l.jpg

BioinformaticsATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCTTGGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAACAAAACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATGCTCATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGCTTGTATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTTATGAAGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACACATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTCACGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATATCATCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCGGTCGTTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCATTATCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGTGAATATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTCCTATTAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGGGACAATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCATGTAATACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTAAATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGTTTTCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTTTGGTTTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCTTTGCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTCAAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGATATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAACAAGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTACCAAAAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGTAGAAATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGGTGTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGCAATTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGTAATATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTGAGGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCT

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAG

PCR

DNA extraction

Insect identification

?

DNA sequencing

Gel electrophoresis

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCA


Slide4 l.jpg

  • WHAT ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCTTGGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAACAAAACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATGCTCATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGCTTGTATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTTATGAAGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACACATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTCACGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATATCATCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCGGTCGTTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCATTATCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGTGAATATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTCCTATTAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGGGACAATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCATGTAATACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTAAATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGTTTTCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTTTGGTTTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCTTTGCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTCAAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGATATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAACAAGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTACCAAAAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGTAGAAATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGGTGTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGCAATTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGTAATATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTGAGGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTtypes of biological insights can DNA sequence data provide?

  • WHEN and WHY would we want to obtain this detailed information?

  • HOW is DNA sequencing actually performed?

  • WHO conducts DNA sequencing,and WHERE?


Slide5 l.jpg

DNA sequence of a particular geneATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCTTGGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAACAAAACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATGCTCATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGCTTGTATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTTATGAAGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACACATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTCACGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATATCATCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCGGTCGTTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCATTATCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGTGAATATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTCCTATTAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGGGACAATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCATGTAATACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTAAATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGTTTTCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTTTGGTTTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCTTTGCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTCAAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGATATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAACAAGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTACCAAAAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGTAGAAATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGGTGTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGCAATTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGTAATATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTGAGGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCT

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAA

DNA sequencing

What good is it?

What questions about this organism can DNA data help us to address?


Slide6 l.jpg

How is this organism related to other species?ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCTTGGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAACAAAACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATGCTCATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGCTTGTATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTTATGAAGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACACATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTCACGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATATCATCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCGGTCGTTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCATTATCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGTGAATATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTCCTATTAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGGGACAATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCATGTAATACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTAAATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGTTTTCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTTTGGTTTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCTTTGCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTCAAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGATATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAACAAGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTACCAAAAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGTAGAAATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGGTGTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGCAATTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGTAATATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTGAGGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCT

K

?

C

A

H

F

I

J

D

B

E

G


Slide7 l.jpg

DNA sequences provide characters that are: ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCTTGGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAACAAAACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATGCTCATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGCTTGTATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTTATGAAGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACACATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTCACGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATATCATCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCGGTCGTTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCATTATCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGTGAATATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTCCTATTAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGGGACAATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCATGTAATACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTAAATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGTTTTCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTTTGGTTTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCTTTGCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTCAAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGATATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAACAAGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTACCAAAAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGTAGAAATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGGTGTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGCAATTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGTAATATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTGAGGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCT

  • Numerous, discrete characters (A, T, C, G)

  • Directly comparable across species

  • Unlikely to change due to culture conditions

  • Can be sampled without ever culturing (important for endosymbionts!)

Molecular phylogenetics:

Inference of evolutionary relationships based on molecular data

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTCAATACGCGTGCTCAGGCAGATAAAATATTA


Slide8 l.jpg

Ribosomal RNA (rRNA)ATGTTCTATCCCATTCATTTTGACGTTATTGTTGTTGGAGGAGGTCATGCTGGGACAGAAGCAGCTTTGGCTTCTGCTAGGATGCAATGTAATACGCTTTTGATTACTCATAATATTGATACTCTTGGACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCTTGTTATATTACCCATACTAATAACAAAACACATGAAATAGTTAGATCAAATTTATATCAGAGTCCTATGTATACAGGTTTAATAAAAGGAATAGCACCTCGGTATTGTCCATCTATAGAAGACAAAATAACTCGTTTTTCAGATCGTAATGCTCATCAAATTTTTTTAGAACCTGAAGGTTTGACAACACCTGAAGTATATCTTAATGGTATTTCTACTAGCTTACCTTTTTGTGTACAAATGCAAATGATTAAATCAATTCAGGGATTAGAGAATGCTTGTATAATTAGGCCAGGTTATGCTATTGAATACGATTTTTTTGATCCTCGTGATTTAAAATTAACATTAGAGAGTAAAATTATTTCTGGATTATTTTTTTCTGGTCAAATTAATGGTACTACTGGTTATGAAGAAGCAGCTGCCCAAGGATTATTGGCCGGAATTAATGCAGCTAGGTTTTCCAAAAATAAAGAAGGATGGTACCCTAGAAGAGATCAGGCATATTTAGGGGTGCTTGTAGATGATCTCTGTACACATGGAACAGAAGAACCTTATCGTATGTTTACTTCGCGTGCTGAATATCGTCTGTCTTTACGTGAGGATAATGCTGATTTAAGATTAACTGAAATCGCGCGACAGTTAGGTTTGATAGATGAGTCACGGTGGAAAGCTTTTTGTTGCAAAAAAGAAAACATTGAAAAAGAACGTCAGAGATTACGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGTTTATGTCAGGAATCAAAGGCACTTCCCAAGAATATATTGGACATCATTTATATCATCTGCAATTTGATTTAAGTACTTTTTCGTTAGTGAGCTCGGAGAATACTTCTTCATTCTGGGTATTAAATGTAGATTCGATGTTTTTTTCAATATTATTGGCTACTTTATTTTTATTAATTTTCGGTCGTTTGGCTACAGTGGCAACTTATGCGGTTCCCACAAAACTGCAAGTGTTTATTGAGTTAGTAATATTGTTTATTGATAGCAATGTAAAAGATATGTTTCATGGTAAAAATAAACTAATTGCGCCATTATCTATGACGGTTTTTGTTTGGATTTTTTTAATGAATACCATGGATTTATTTCCCATAGATTTATTTCCTGCTATAGCTAAATTGTTAGGATTACCTGCTTTACGTGTTGTGCCGTCTGCCGATGTGAATATCACTTCTTCGCTAGCTTTAAATGTATTTGTACTTGTTATGTACTACAATATTTACGTTAATGGCGTTCATGGTTTTATTAAAGGACTGATGTATCATCCATTTAATCATCCAACATGTATTCCTATTAATTTTATTATTGAAGTTGTTAGTTTGTTATCTAAACCAGTATCACTTAGTCTTAGATTATTTGGCAATATGTATTCTGGTGAGTTGATTTTTATTTTGATATCTGGTTTATTACCATGGTGGGGACAATGGGTTTTAAATTTACCATGGGCTATTTTTCATATTTTAGTCGTTACATTACAGGCTTTTATTTTTATGGTTTTAACGGTGATTTATTTATCTACAGCCCATGACTCCTGTTAAAATGAATCATGTAATACAGAAGATTGCAGAGAGGTTATTATGGAACATTTAAATTTTGATATGTTATATATTGCTGCAGCAATAATGATGGGATTAGCAGCAATTGGAGCGGCTATCGGTATTGGCATCTTAGGTAGTAAATTTTTAGAGGGGGCTGCACGTCAACCAGATCTCATTCCGATCCTTCGAACTCAGTTTTTTATTGTTATGGGATTGGTTGATGCAATACCAATGATTACTGTAGGTCTTGGTTTGTATGTGATGTTTTCTGCGGTTTAACAATGAAAATTAATTGCATGTATTTATTATATTGATTATTAAATATCAGGATTTGCGCTGTGAATCTTAATGCAACAATATTAGGTCAAACTATTTCATTTGTTTTGTTTGTTTGGTTTTGTATGAAGTATGTGTGGTATCCATTTATATCTATTATTGAGAAACGCCAAAAAGAAATTTCTGATAATTTAGTTTCTGCTACTCATGCCAAAACAGAATCTGAGCGTGTCAATGCTGAAGCTTTGCTTTGTTTGAGACAGGCTCGGGTCAAAGCTCAAGAAATTATAAAACAAGCAAATAAATGTAAAATGCAAATAATTAATGAAGCTAAACATGAAGCTGAAAAGGAGCAAAGTAGAATTTTATCTCAAGCGCGAGAACAGATTATTTATGAAAGAAAACGTGTTACTGACGAATTAAGAAAGCAAATTAGCGAACTTGTAATTGAGGGTACAGAGAAAGTTATAGAACATTCTATAAATGAAATGATTGATATAGATCTTTTAAATAATATTATTAATACGTTGTCATATAAGGATTAGATGTCTAGTATGCTTGTGGTTGCGCGTACGTATGCTCAAGCTATATTTGATATAGCTGTAGAACAGAAAAATATAAACAAGTGGAAATCAGTTCTTGATTTATTTTCTGAGATTAGTCTAAATAGACTAGTACAATCTTTATTTTTTAGATGTTTAGAACCAAAAAGATTGTCAGATATATTTATTGCTATTTGTGAAGATTACCAAAAGAAACAAGTTGATACCTTCAGTAAAAATATAATCTATATTATGGCGGAAAATAATCGTTTATTATTATTACCAATTGTATTTAAAGAGTTTACTTATTTATGTTCTATATATGTTCATACTGTAGAAATAGAAATTATCTCTGCTTGGCCTTTGAAGTATAATCAGCTGAAAAAAATTACTGATATAATGGCTAAACGTTTATCTAAAACAGTGAATCCAGTACACAAAGTAGATAAAGATATATTGGCTGGTGTAATTATTCGTATTGGAGATACTGTGATTGATGGAAGTATACGTGGACGTATTTTTCGCTTAAATCACGTACTACAATCTTAATATTTTAACAGTAGTTAAAAGGTATAAACAAAAGATTATGCAATTAAATTCAAATGAAATTTCAGATAATGGAGAAGTTATTATTAATGATTTAAAGTTATTTTATAATAAAGCTAGACAAACTAAAATTACAGAAGAACTTACAGAAATTGTTTCAGGAGCTTCTGTAATATAAACTTAAAAGATAGTTAGAGGTATAATTAATATGAGTTCTGGAAAAATTGTCCAGGTTATTGGAGCGGTGGTTGATGTTGCGTTCAATCAAGATGTGGTACCGACTGTATACCATGCACTTGAGGTGTAATACTTATATTTTCCCGTATAGCTCAGATGTTGCACAATTAAATAATTTTCTTAAAACACCTTTAACACATGAAACAAATGGCGAAGATCTTTTGAGAAGGCCAGAAATTAATTATAAAAAGTTATCTCAACTAAGTACTTTTAGTCCATCTATATTGGATCGTCAAGTATTCGAGCAAATTGAAATTCAAATAAAATATGAAGGTTATATTCGTCATCAACAAGAAGAAATAAAGAGACATATTTATAATGAAAATACATTGTTACCGACTGATATAGATTTCAATATTGTTTCTGGATTATCTCAGGAGGTCATTGACAAACTCAATAATTATAAACCTTATTCTATTGGGCAGGCTTCTCGCATTTCTGGTATCACTCCTGCGGCTATTTCTAATTTATTGGTTTGGTTAAAAAAACAAGGTTTGTTAGAGCATAATACATGCTAATCTGTTGAATAATGTATTTTCTATTAATCAAGGTATTATTTAATTTCCTATATAGGGTGTTTGTGATTGTTACAATATGGAGAGAGTTGATCGTGTAGAAAACCGGTATATTTATGTCTTTTCCAATAATAATTTTATAGAAATAATAATAGTAATTAGATTATTATTTTAATGGGTTTGTTATGTATGGCATTATTTTTAATATTATACGGTTGTTTATACGTATCTAAATTTGCGCTTTGAATTTTTTTGAAAATAGGATTATACTGAACTTTTAGTTGTATACAAGTGTATTATTTCATATTTTTGAATAAATATACGTGCTGTACTAATGGTTATTAATTACAAGATAAATTACTTGTCGACCGAACTATAGTTCGGTCGTGTGTTTGTTTCTGTAAGTTGTAACATATTATGTGAAATTTACTAATTAATTCATAGTGTCATTTTAATTCTCTTTTATTGCATTAGTATATGGTTGTGTAAAAAGAGAGAGAGTGTTCTTGTTATTTTCTATTAGTACTAATTTTTTAAAAGTTGATGCAGGCACTGTCGTTCTTTTCGGATACAACATCATTGTAAGTTATATATAAAAATGATTTAGAATTTCGACATGTTAGTGACAAGTTGTATATCGAGGTTGTAATGTTGTATTATACAAGAACATTGTAAAATATTTATAGTATATTGCAGCCAATATTTTTTGAAAGGTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCAAGCGTCAGTAGAAGATTTAATAGTTAGTGGGAACAAGATTGTTGGAGTAATTACTCCAAAATTAGGAATGAAATTTAGTGGTACGTCTGTTGTGTTGACAACCGGAACCTTTCTCAATGGTAAGATTCATATTGGGATGAATAATTTTAGAGGAGGTCGATCTGGAGATTCGGAGTCATCGTCATTGTTATCAGAGCGATTGAAAGAATTGTCTTTTCAGATTAGTCGGTTAAAAACGGGTACTTCTCCTCGTGTGCATACCAAAGGGATAAATTTTGGTTCTTTACGTGCACAATATAGTGATGATCCCATTCCTGTGTTTTCATTTATAGGATCTACAAAACTACATCCTACGCAGGTGCCT

  • Ideal gene for phylogenetic studies because it :

  • is an essential gene that is present in all organisms.

  • is a common target for sequencing studies; large database for comparisons.

  • contains sites that are relatively conserved (stems) and sites that are more free to vary (loops).

Molecular Phylogenetics

Step 1. Select a DNA region that is homologous, or similar across species due to common ancestry.

Secondary structure

of 16S rRNA in E. coli


Slide9 l.jpg

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT

PCR

Sequence the

PCR product

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGGTFTGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATTTAGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT

2. Amplify andSequence this region across isolates….


Slide10 l.jpg

Good alignment.ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT

Species “I” has probably experienced a deletion event at position #6 or #7.

Poor alignment

Implies that species “I” is divergent from the others, but this is not the case.

3. Sequence alignment is crucial for inferring how DNA sites have changed.


Slide11 l.jpg

4. Estimate relationshipsACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT based on extent of DNA similarity.

At variable DNA positions, related groups will tend to share the same nucleotide.

The sheer number of characters is helpful to distinguish the ‘phylogenetic signal’ from noise.

ATGTTGGCAGTCCGATGTAAGC

ATGTTGGCAGTCCGATGTAAGC

ATGTTGGCAGTCCGATGTAACC

ACGGTAGCAGTCTGATGTATCC

ACGGTAGCAGTCTGATGTATCC

ACGGTAGCAGTCTGATGTATCC

CTGCTGGTAGTCGTTTGTAACC

CTGCTGGTAGTCGTTTGTAACC

CTGCTGGCAGTCGGTTGTAACC

ATGCTGGCAGTCGGGTGTAACC

Molecular phylogeny of taxa A-I.

ATGGTGGCAGTCGGGTGTCACC

Colored letters = different from top sequence (taxon G)


Slide12 l.jpg

Example: ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTMolecular phylogenies have revealed unexpected features of bacterial evolution.

For instance, an endosymbiotic lifestyle has evolved several times independently.

Moran and Wernegreen (2000)


Slide13 l.jpg

“Blast”ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT sequence

to Genbank

Blast output:

Lists sequences that are most similar to yours

GENBANK = NIH genetic database with all publicly available DNA sequences. As of 2004: > 44 billion bp, and > 40 million sequences

How does this organism fit into the world of available sequence data?

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT

PCR

Sequence the

PCR product


Slide14 l.jpg

?ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT

“Blast” sequence

to Genbank

YES!!

Blast results:

Wolbachia sp. 1

Wolbachia sp. 2

Wolbachia sp. 3

….

Is the bacterium inside this insect really Wolbachia?

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT

PCR and sequence a gene of interest

(e.g., 16S rDNA)


Slide15 l.jpg


Slide16 l.jpg

Fred Sanger provide?

The elegant idea behind DNA sequencing

Technology changes quickly, but for many years we’ve on Sanger’s cool trick.

In the 1970’s, Sanger’s group discovered a fundamentally new method of 'reading' the linear DNA sequence using special bases called chain terminators. This method is still in use today.

What is the basis of Sanger’s method?

Shared with Walter Gilbert and Paul Berg


Slide17 l.jpg

•  Deoxynucleotides (dNTPs) are the building blocks of DNA. • dNTPs are held together by phosophodiester bonds, which comprise the backbone of the DNA chain.

Figures in this and subsequent slides from Hartl and Jones,

Essential Genetics, 1999

[removed here]


Slide18 l.jpg

• DNA is replicated 5’ to 3’. DNA. • The addition of a new deoxynucleotide in DNA synthesis depends on the presence of that 3’-OH.


Slide19 l.jpg

= chain termination


Slide20 l.jpg

Fascinating. Now how do we DNA. actually sequence ??


Slide21 l.jpg

PCR DNA.

DNA extraction

Insect identification

?

PCR products

Gel electrophoresis


Slide22 l.jpg

On to sequencing…. DNA.

clean PCR product

+ water

DNA Sequencing:

Step 1: Purify template (the DNA to be sequenced)

PCR clean-up

Amplified DNA

+ used Taq

+ extra primer and dNTPs

+ salts from PCR buffer, etc….


Slide23 l.jpg

Step 2: Set up DNA. cycle sequencing reaction

DNA PRIMER

DIDEOXYNUCLEOTIDES

NUCLEOTIDES

TEMPLATE DNA (e.g., YOUR PCR PRODUCT)


Slide24 l.jpg

Today, nearly all sequencing is DNA. Fluorescence-based, and uses chain terminators that are labeled with different dyes.

The dyes are “spectrally distinct,” and each has a different emission wavelength.


Slide25 l.jpg

denaturation DNA.

Product

extension

Primer annealing

Step 3: Perform cycle sequencing in PCR machine

Reaction steps seems a lot like PCR, but not quite…


Slide26 l.jpg

Go to: DNA.

http://www.dnalc.org/ddnalc/resources/animations.html

>> Cycle sequencing


Slide27 l.jpg

Use of DNA. capillaries filled with a matrix for higher through-put of sequencing reactions.

e.g. ABI 3730


Slide28 l.jpg

In sum: From PCR to sequence data DNA.

2. Set up sequencing reaction

1. Purify PCR product

3. Perform cycle sequencing

5. Read order of terminators (DNA sequence)

4. Resolve sequence fragments


Slide29 l.jpg

  • Quality DNA. of sequence data may vary, depending on:

  • Purity and concentration of template DNA

  • Presence of extra PCR bands (artifacts)

  • Quality of dye-terminators, electrophoresis matrix, and other reagents

    Ideally, look at chromatograms and convince yourself that base calls are robust.


Slide30 l.jpg

PCR PRODUCT of 1,200 bp DNA.

Sequence read #1

Sequence read #2

Sequence read #3

DNA sequence assembly: Combining sequence reads to build the entire sequence of the template DNA

  • Sequence “reads” typically range from 500-800 bp. Often the total DNA fragment is much longer.

  • Regions of overlap among sequence reads:

  • Let us piece together the linear “puzzle” of the template DNA sequence.

  • Often confirm base calls and improve overall add data quality.



Slide32 l.jpg

+ PCR Reagents DNA.

+ Emulsion Oil

Create

“Water-in-oil”

emulsion

Link DNA fragments to beads (one fragment per bead)

Isolate DNA-containing beads

Perform emulsion PCR

Steps in “next-generation” sequencing

A

B

Attach adaptors (A and B) to ends of DNA fragments

  • This generates millions of clonally amplified (identical) DNA fragments on each bead


Slide33 l.jpg

44 um DNA.

Load Enzyme Beads

Load DNA beads

One bead per well

PicoTiterPlate(a fancy microtiter plate with >400,000 wells)

~400 wells per

sq. millimeter


Slide34 l.jpg

Pyrosequencing - DNA. Sequence by synthesis, not electrophoresis.

Peaks in pyrogram reflect nucleotide sequence

=pyrophosphate

= pyrophosphate

dNTP’s are added one at a time to the reaction. Incorporation of one (or more) nucleotide(s) that are complementary to the template results in a chemiluminescent signal, which is recorded by a camera and reflected as a peak in a ‘pyrogram.’

~500 MB on one plate, in just a few hours.


Slide35 l.jpg

  • WHAT types of biological insights can DNA sequence data can provide?

  • WHEN and WHY would we want to get this detailed information?

  • HOW is DNA sequencing actually performed?

  • WHO conducts DNA sequencing and has access to the data? WHERE is sequencing performed? How might these things change in the future?


Slide36 l.jpg

Major sequencing centers provide? have facilities to sequence multiple full genomes each year

  • Due to genomic research over the past decade, DNA sequencing has become:

  • Increasingly automated

  • Higher-throughput

  • Less $$ per reaction

  • And (good news) more accessible to researchers and educators


Slide37 l.jpg

Possible avenues provide? for DNA sequencing:

Many public universities to have DNA sequencing facilities in house.

Such facilities are usually able to run small numbers of reactions for a cost of ~$10-15 per reaction, but often much less for “internal users” with ties to the university.

Ideal situation: Team up with faculty at your local university to act as facilitators.

  • Even if DNA sequencing not an option for classroom labs, important to discuss:

  • how DNA sequencing is performed,

  • how data is evaluated,

  • ethical issues surrounding its interpretation and use.


Slide38 l.jpg

Ethical issues involving DNA sequencing provide?

Truro: A tranquil Cape community shaken by the murder of a young woman in January 2002



Slide40 l.jpg

Should scientists attempt to clone the now-extinct Thylacine to revive this species?? (The technology will be there eventually.)

Thylacine pup preserved in alcohol in 1866. Its cells could be used for cloning. By chance this Thylacine was stored in a jar of alcohol rather than formalin, which would have destroyed the DNA.


Slide41 l.jpg

Take-home messages to revive this species?? (The technology will be there eventually.)

  • WHAT, WHEN and WHY?

    DNA data provides new insights into evolutionary relationships, including closest matches in vast public databases.

  • HOW?

    Though technology changes rapidly, chain termination, developed in the 1970’s, remains central to much DNA sequencing.

    However, much faster and cheaper approaches are gradually replacing these methods.

  • WHO and WHERE?

    Increasingly accessible, DNA sequencing is already woven into the fabric of health and legal systems.

    Evaluating DNA evidence is key in debates of ethics and policies surrounding medical care, individual privacy, and conservation of biodiversity.


ad