SNPs
Download
1 / 61

~1nt difference every 160 nt - PowerPoint PPT Presentation


SNPs. ~1nt difference every 160 nt . ~1nt difference every 160 nt . YJM789 a lys2 LYS5 HO drug r. X. S96 a LYS2 lys5 ho DRUG S. a lys2 LYS5 ho drug r. 10 spores. YJM789 a lys2 LYS5 ho drug r. X. S96 a LYS2 lys5 HO DRUG S.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha

Download Presentation

~1nt difference every 160 nt

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


SNPs

~1nt difference every 160 nt


~1nt difference every 160 nt


YJM789a lys2 LYS5 HOdrugr

X

S96 a LYS2 lys5 hoDRUGS

a lys2 LYS5 ho drugr

10 spores


YJM789a lys2 LYS5 ho drugr

X

S96 a LYS2 lys5 HO DRUGS

a lys2 LYS5 ho drugr

10 spores


a drugr

a pdr5

YJM789a lys2 LYS5 ho drugr

X

a pdr5

drug resistant?


Sears et al., Fig. 2


Sears et al., Fig. 3

1 Ura+ Lys-

1 Ura- Lys-

1 Ura+ Lys+

1 Ura- Lys+

2 Ura- Lys-

2 Ura+ Lys+

1 Ura+ Lys-

1 Ura- Lys-

2 Ura- Lys+


Sears et al., Fig. 2


The geneticist’s questions

a) What is consequence of reduced gene function?

b) What is the consequence of increased gene function?

c) What does the gene (protein) interact with?

When and where is the gene (protein) expressed?


The geneticist’s toolkit

Genetical

1) Mutations

point,deletion, RNAi

2) More mutations

enhancers, suppressors

3) Gene overexpression (gain-of-function)

Molecular biological

4) Measure gene expression

reporter genes, Northern blot, RT-PCR, in situ hybrdz

DNA microarrays

5) Protein interaction

2-hybrid

pull-down


1978


URA3

URA3

URA3

URA3

AmpR

  • low freq. transformation

  • ~ 1-10 / ug

YIp

polylinker

ori

  • stable transformants

  • (integrated)

  • low copy #

  • (integrated)

  • DNA homol. req.


Ars

URA3

AmpR

  • hi freq. transformation

  • >103 / ug

YRp

polylinker

ori

  • unstable transformants

  • (autonomous)

  • > 90% plasmid loss

  • moderate copy #

  • (~ 20/cell)

  • homol. recomb. NOT req.


URA3

2

  • hi freq. transformation

  • ~ 103 / ug

AmpR

YEp

polylinker

ori

  • stable transformants

  • (autonomous)

  • < 1% plasmid loss

REP1

REP2

FLP

  • hi to very hi copy #

  • (~ 50-1000/cell)

  • homol. recomb. NOT req.


Ars

URA3

AmpR

  • hi freq. transformation

  • > 103 / ug

polylinker

YCp

ori

  • stable transformants

  • (autonomous)

  • < 1% plasmid loss

CEN

  • low copy #

  • (1-3/cell)

  • NO DNA homol. req.


Ars

Ars

URA3

URA3

ori

polylinker

AmpR

CEN

AmpR

polylinker

TEL

rsn site

YAC

TEL

ori

CEN


Cloning genes by complementation

Ars

URA3

genomic

fragments

AmpR

YCp

ori

CEN

yfg-


Glu

protein

kinase?

URA3

2

High copy suppressors

AmpR

genomic

fragments

YEp

ori

REP1

REP2

FLP


The geneticist’s questions

a) What is consequence of reduced gene function?

1) gene knockout (deletion)

b) What is the consequence of increased gene function?

c) What does the gene (protein) interact with?

When and where is the gene (protein) expressed?


Tag 1

PCR

Tag 2

kanMX4

ATCGGATTCATAACTGATAG

GCTTACTGAAACTGAAACTC

Ron Davis et al., Stanford University

Each deletion strain tagged with two unique 20mers

kanMX4


“Bar-coding gene deletions

ATCGGATTCATAACTGATAG

GCTTACTGAAACTGAAACTC

kanMX4

YFG

kanMX4

Ron Davis et al., Stanford University


Hybridize labeled tags to

oligonucleotide array

containing tag complements

Each tag has unique location

Bar-coded

gene deletions

Ron Davis et al., Stanford University


.

.

.

.

.

.

One tag One Deletion Strain

1

GATTCGATAGCCGGCAAGG

CGATTTAGGAATGTCATAG

2

.

AGCTCATACCTAGTAACTA

3

.

.

AGCTCATACCTAGTAACTA

6,200

Ron Davis et al., Stanford


Apply Selection

Determine who is missing.

Parallel analysis of deletion strains

Determine who is here.


Parallel Analysis of Gene Function

Before selection

Strains are present in equal abundance in the population and produce signals of equal intensity on the chip

After multiple population

doublings under selection

Strains with a growth defect are under-represented in the population and produce a lower intensity signal

Ron Davis et al., Stanford University


Bar-codes reveal genes required for growth

Winzeler et., 1999 Science 285:901-906


Figure 5: Growth of deletion strains exhibiting reduced fitness in galactose media.

Guri Giaever et al. et Ron Davis et al., Stanford


Results

Conventional analysis

~25% have growth defect

17.6% dead (~ 1100 essential genes)

~ 8% slow growth

Parallel analysis

~40% have growth defect(<98% of wt growth rate)

  • Many new genes implicated in key biological processes

  • Gene regulation poorly predicts mutant phenotype


The geneticist’s questions

a) What is consequence of reduced gene function?

gene knockout (deletion)

b) What is the consequence of increased gene function?

What does the gene (protein) interact with?

suppressors, enhancers

When and where is the gene (protein) expressed?


X

gene X

yfg1

X


S

R

S

R

S

S

R

R

bni1::NatR

yxx::KanR


Parallel pathways revealed

in double mutants

Mutations in 1, 2, 3 are

“synthetic lethal”

with mutations in 4,5

1

4

2

5

3


The geneticist’s questions

a) What is consequence of reduced gene function?

gene knockout (deletion)

b) What is the consequence of increased gene function?

What does the gene (protein) interact with?

suppressors, enhancers

When and where is the gene (protein) expressed?

protein localization


GFP

your favorite gene

your favorite

protein

GFP


Protein localization images

Nucleus

Nuclear periphery

Endoplasmic reticulum

Bud neck

Mitochondrion

Lipid particle


The geneticist’s questions

a) What is consequence of reduced gene function?

gene knockout (deletion)

b) What is the consequence of increased gene function?

What does the gene (protein) interact with?

suppressors, enhancers

physical interaction

When and where is the gene (protein) expressed?

protein localization


MATa

MAT

prey

prey

bait

bait

X

AD

AD

BD

BD

HIS3

Uetz et al et Fields, 2000


Activation domain

array

Uetz et al et Fields, 2000


Uetz et al et Fields, 2000


Activation Domain Array

mated to

DNA-binding domain-Pcf11

plated on -His (-Leu -Trp)

Activation domain

array

Uetz et al et Fields, 2000


GST

your favorite gene

your favorite

protein

GST


ID by mass spec


Gavin et al., NATURE 415, 141 (2002)


Gavin et al., NATURE 415, 141 (2002)


The geneticist’s questions

a) What is consequence of reduced gene function?

gene knockout (deletion)

What is the consequence of increased gene function?

high-copy plasmids, strong promoters

What does the gene (protein) interact with?

suppressors, enhancers

physical interaction

When and where is the gene (protein) expressed?

protein localization


Each gene

overexpressed

promoter

gene 1

promoter

gene 2

promoter

gene 6000


The geneticist’s toolkit

Genetical

1) Mutations

point,deletion, RNAi

2) More mutations

enhancers, suppressors

3) Gene overexpression (gain-of-function)

Molecular biological

4) Measure gene expression

reporter genes, Northern blot, RT-PCR, in situ hybrdz

DNA microarrays

5) Protein interaction

2-hybrid

pull-down


Four volumes of

the Encyclopedia of Life

6000

genes

12,000

genes

19,000

genes

25,000

genes


Determination of

mating type

A developmental

pathway

Becker Medical Library

QW 161.5 .C6 P975g 1992


ad
  • Login