Functional alleles intermediate phenotypes in alcoholism and dyscontrol disorders
Download
1 / 66

Functional alleles intermediate phenotypes in alcoholism and dyscontrol disorders - PowerPoint PPT Presentation


  • 1583 Views
  • Uploaded on

Functional alleles & intermediate phenotypes in alcoholism and dyscontrol disorders David Goldman [email protected] 1935-2006 Begleiter, H., and Platz, A. (1969). Evoked potentials: Modifications by conditioning.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Functional alleles intermediate phenotypes in alcoholism and dyscontrol disorders' - LionelDale


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Functional alleles intermediate phenotypes in alcoholism and dyscontrol disorders l.jpg

Functional alleles & intermediate phenotypes in alcoholism and dyscontrol disorders

David Goldman

[email protected]


Slide2 l.jpg

1935-2006 and dyscontrol disorders


Slide3 l.jpg

Begleiter, H., and Platz, A. (1969). and dyscontrol disorders

Evoked potentials: Modifications by conditioning.

Science 166:769-771.Begleiter, H., Porjesz, B., Yerre, C., and Kissin, B. (1973).

Evoked potential correlates of expected stimulus intensity.

Science 179(4075):814-816.Begleiter, H., and Porjesz, B. (1975).

Evoked brain potentials as indicators of decision-making.

Science 187:754-755.Begleiter, H., and Porjesz, B. (1975).

On evoked potentials, cognition, and memory.

Science 190:1004-1006.

Begleiter, H., Porjesz, B., and Chou, C.L. (1981).

Auditory brainstem potentials in chronic alcoholics.

Science 211:1064-1066.

Begleiter, H., Porjesz, B., Bihari, B., and Kissin, B. (1984).

Event-related potentials in boys at risk for alcoholism.

Science 225:1493-1496.


Slide4 l.jpg

The heritability of addictive disorders and dyscontrol disorders

h2

+ range

Alcohol (9897)

Opiates (3494)

Cocaine (2206)

Caffeine (6997)

Cannabis (7659)

Sedatives (4758)

Gambling (3359)

Smoking (10620)

Stimulants (2212)

Hallucinogens (4570)

Nature Genetics Reviews, 2005


Alcoholism and other addictions the intermediate phenotypes l.jpg
Alcoholism and other addictions: and dyscontrol disordersThe intermediate phenotypes

Frontal cortical function/behavioral inhibition

Drug metabolism and response/tolerance

Reward

Anxiety-dysphoria/stress response

Obsession/Craving

Electrophysiology

Imaging: brain structure and function

Neuropsychology

Metabolomics

Gene expression


Slide6 l.jpg

Gene, stress, & substances in dyscontrol and dyscontrol disorders

MAOA rare & common alleles: GxE, fMRI

COMT Val158Met: Roles in cognition & resiliency

HTTLPR: GxE for depression and suicidality


Genes with alleles proven to modulate human behavior l.jpg
Genes with alleles proven to modulate human behavior and dyscontrol disorders

Rare

Deterministic

MAOA Brunner Syndrome

HTT OCD

HPRT Lesch-Nyhan Syndrome

ERBA ADHD

MAOA* Dyscontrol

HTT* Anxiety, OCD

COMT Cognition, anxiety

BDNF Episodic memory

ALDH2 Alcoholism

ADH1B Alcoholism

Common

Probablistic

*Regulatory


Slide8 l.jpg

For risk genes, odds ratios and dyscontrol disordersare larger for Intermediate Phenotypes than forDiseases (Wellcome Trust medians)

Median of 24 disease loci

Disease

T2D

BP

T1D

CAD

Crohn

RA

HTTLPR/

HA

MAOA/

Amygdala fMRI

MAOA/

Hippo fMRI

Intermediate

phenotype

HTTLPR/

Amygdala fMRI

WCST/

COMT

MAOA/

Orbitofrontal fMRI

1

2

3

4

5

6

Odds ratio


Slide9 l.jpg

. and dyscontrol disorders

.

.

.

.

.

Brunner syndrome: X-linked dyscontrol due to the MAOA C936T stop-codon

Unaffected

  • Borderline mental

  • retardation

  • Dyscontrol behaviors:

  • Aggressive outbursts

  • Arson

  • Attempted rape

  • Exhibitionism

C

C

C

T

C

T

C

C

T

T

T

C

C

C

T

C

C

C

T

C

C

C

T

C

No fibroblast MAOA activity

Abnormal monoamine metabolism:

↓ urinary HIAA, HVA, VMA

↑ urinary normetanephrine & tyramine

Brunner et al.,

Science, 1993


Slide10 l.jpg

Expanding the stress connection to behavioral dyscontrol: Predisposition, early exposure, and substance abuse


Child sexual abuse and psychiatric disorders in females l.jpg
Child sexual abuse and psychiatric disorders in females Predisposition, early exposure, and substance abuse

  • ASPD 2.9 [1.4-6.0]

  • Alcoholism [Abuse +Dep] 2.1 [1.2-3.6]

  • Substance abuse 4.2 [2.2-7.8]

  • Affective disorder 2.3 [1.3-4.0]

  • Anxiety disorder 1.8 [1.0-3.1]

  • PTSD 5.3 [2.2-12.7]

Robin et al, Amer J. Psychiatry, 1997


Addictions a cause and effect of stress trauma and dyscontrol l.jpg
Addictions: A cause and effect of stress/trauma and dyscontrol

  • Key factor in accidents, violence and sexual trauma

  • A consequence of trauma

  • Consequences of underage drinking

  • A cause of allostatic changes

  • Genes mediate liability


Slide13 l.jpg

Alcoholics Tend to Be Anxious dyscontrol

*

*

HA

(±SE)

*

*

Controls

AD, ASPD -

AD, ASPD +

Plains Indian

(350)

Finns

(433)

COGA (511)

Bethesda

(148)

Ducci et al, 2007


Slide14 l.jpg

Allostasis and Addiction dyscontrol

G. Koob, B. McEwen


Slide15 l.jpg

A functional promoter polymorphism ( dyscontrolMAOA-LPR) predicts MAOA expression

MAOA promoter

MAOA

Repeats

3

3.5

4

5

ACCGGCACCGGCACCAGTACCCGCACCAGT

vector

3

5

3.5

4

vector

3

3.5

4

5

vector

3

3.5

4

5

Sabol et al, Hum Genet, 1998


Slide16 l.jpg

GxE interaction of dyscontrolMAOA-LPR and childhood maltreatment on antisocial behavior, in males

Composite index of

antisocial behavior (z scores)

Childhood maltreatment

Caspi et al. Science., 2002


Slide17 l.jpg

MAOA dyscontrolpromoter

GxE interaction of MAOA-LPR & childhood sexual abuse for ASPD & alcoholism

MAOA

Repeats

3

3.5

4

5

ACCGGCACCGGCACCAGTACCCGCACCAGT

Ducci et al, Molecular Psychiatry, 2007

1.00

ASPD + AUD

0.80

AUD, no ASPD

0.60

Unaffected

Population fraction

0.40

0.20

0.00

3/3

3/4

4/4

3/3

3/4

4/4

Yes

No

Childhood Sexual Abuse


Slide18 l.jpg

Non-additive interaction of dyscontrolMAOA-LPR and testosterone predicts antisocial behavior

ASPD + AUD

AUD, no ASPD

no AUD, no ASPD

Low activity MAOA-LPR

High activity MAOA-LPR

35

35

30

30

25

25

20

20

Brown/Goodwin

Lifetime Aggression

15

15

10

10

5

5

0

0

100

200

300

400

500

600

100

200

300

400

500

600

Testosterone (pg/mL)

ba (SE) = 3.49 (1.01); p=0.001

ba (SE) = -0.94 (1.04); p=0.37

Sjoberg et al., Neuropsychopharmacology 2007


Slide19 l.jpg

MAOA-LPR predicts differential fMRI activations to angry and fearful faces in limbic and paralimbic regions (n = 142)

Subgenual

Cingulate

Supragenual

Cingulate

Orbitofrontal

Cortex

L Amygdala

Andreas Meyer-Lindenberg (2006) PNAS 103, 6269-6274


Slide20 l.jpg

MAOA-LPR predicts fMRI limbic activations during retrieval of aversive memories (n = 90)

L Amygdala

L Hippocampus

Andreas Meyer-Lindenberg (2006) PNAS 103, 6269-6274


Slide21 l.jpg

rhMAOA-LPR of aversive memories (n = 90)


Comt val 158 met apparent counterbalancing effects in cognition and stress anxiety l.jpg
COMT of aversive memories (n = 90)Val158Met: Apparent counterbalancing effects in cognition and stress/anxiety

Warrior

Worrior


Slide23 l.jpg

60 of aversive memories (n = 90)

COMT Val158Met and WCST

55

Controls

55

50

Siblings

219

Perseverative Errors (t-scores)

WCST

45

Patients

175

40

35

N = 449

F = 6.00

p = .003

30

Val/Val

Val/Met

Met/Met

Egan et al, PNAS, 2001


Slide24 l.jpg

Fear of Uncertainty (HA2) and of aversive memories (n = 90) COMTVal158Met in females from two populations

6

5

(HA2)

Plains Indian

[N = 148, F=3.5, p=0.03, 2 df]

4

U.S. Caucasian

[N = 75, F=3.5, p=0.09, 2 df]

Val/Val

Val/Met

Met/Met

Enoch et al, Psychiatric Genetics, 2003


Slide25 l.jpg

[ of aversive memories (n = 90)11C]-Carfentanil binding in brain

thalamus

cingulate

globus pallidus,

n. accumbens

amygdala

Source:Jon-Kar Zubieta


Slide26 l.jpg

COMT of aversive memories (n = 90)Met158Val and µ-opioid system activation in response to sustained pain

Zubieta et al, Science, 2003


Slide27 l.jpg

CCCCCCTGCACCCCCC of aversive memories (n = 90)GGCAT

HTTLPR: Still psychiatric genetics’

most popular locus

1200 nt

14 repeats

S allele

HTT

16 repeats

L allele

HTT

A>G

AP2

Hu et al, AJHG, 2006


Slide28 l.jpg

GxE: Interaction of HTTLPR and stress in depression of aversive memories (n = 90)

Caspi et al, Science 2003


Slide29 l.jpg

Gene x Environment (HTT x Childhood stress) of aversive memories (n = 90)

predicts suicide attempts in abstinent,

African American,

Substance Dependent patients (N=306)

HTT genotypes

Low expressing

High expressing

Probability of Suicide

Attempt

CTQ Emotional Neglect

CTQ Physical Abuse

Roy et al, In press


Slide30 l.jpg

Functional Allele to Complex Behavior of aversive memories (n = 90)

GCH1

GABRA2

MAOA

BDNF

Val66Met

COMT

Val158Met

Environmental

Factors

HTT

HTTLPR

Episodic

Memory

Executive

Cognition

Anxiety,

Resiliency

Trauma

OCD

Schizophrenia

Alcoholism

Pain

Marker phenotype


Thanks l.jpg

Mary-Anne Enoch of aversive memories (n = 90)

Zhifeng Zhou

Ke Xu

Xianzhang Hu

Francesca Ducci

Robert Lipsky

Peihong Shen

Qiaoping Yuan

Colin Hodgkinson

Rob Robin

Bernard Albaugh

Alec Roy

Thanks!

Ahmad Hariri

Deborah Mash

Rajita Sinha

Jon-Kar Zubieta

Mary Heitzig

David Scott


Polygenicity multiple genetic variants confer risk in combination l.jpg

Genetic Complexity of aversive memories (n = 90)

Polygenicity: Multiple genetic variants confer risk in combination.

Heterogeneity: Multiple genetic variants confer risk in different individuals.


Slide34 l.jpg

Genetic complexity in affected populations of aversive memories (n = 90)

Polygenicity

Heterogeneity


Slide35 l.jpg

Genetic complexity and twin concordance of aversive memories (n = 90)

Polygenicity

Heterogeneity

MZ

MZ

DZ

DZ

Affected

Unaffected


Slide36 l.jpg

Lack of evidence for polygenic inheritance of addictions of aversive memories (n = 90)

Cocaine

Sedatives

Stimulants

Caffeine

Hallucinogens

Opiates

Gambling

Smoking

Alcohol

Cannabis

2

MZ/DZ

Concordance Ratios

Nature Genetics Reviews, 2005


Slide37 l.jpg

Pain/Stress Challenge: of aversive memories (n = 90)

Hypertonic saline infusion to masseter muscle

Pain

NaCl infusion rate

NaCl

Muscle


Comt yin yang haplotypes in five populations linkage to opioid addiction alcoholism l.jpg
COMT yin/yang haplotypes in five populations & of aversive memories (n = 90)Linkage to Opioid addiction &Alcoholism

V

M

p value

Case/Control

Chinese

0.25

0.24

.003

477/361

African American

.03

0.09

0.08

167/294

German Caucasian

0.28

490/192

0.24

.02

0.15

0.27

Finnish Caucasian

178/283

<.001

Plains Indian

0.09

0.22

175/175


Comt val158met and addiction l.jpg
COMT Val158Met and Addiction of aversive memories (n = 90)

  • Polysubstance abuse: Val158

    • Vandenburgh, Uhl and colleagues

  • Late onset alcoholism: Met158

    • [Hallikainen et al, 2000] 62 early onset, 132 late onset, 267 controls. Odds ratio of 3 for late onset, p=0.017

    • [Tiihonen et al, 1999] 67 & 56 late onset, 3140 blood donors, 267 matched controls. Met/Met vs Val/Val Odds ratio 2.5, p =0.006, Attributable risk for Met/Met vs Val/Val 13.3%


Slide40 l.jpg

COMT Val158Met of aversive memories (n = 90)

Met158

Val158

High anxiety,

Stress reactive

Behavioral

Dyscontrol

Alcoholism and

other substance abuses


Slide41 l.jpg

6 of aversive memories (n = 90)

6

4

4

2

2

0

0

-2

-2

-4

-4

-6

-6

Replication of COMT in experimental pain in 202 females prospectively followed for TMJ (Diatchenko et al, Hum Mol Genetics, 2005)

Mean z-score (± se)

G/G

A/G

A/A

G/G

C/G

C/C

Val/Val

Val/Met

Met/Met

Val158/Met158

rs4818

rs6269

ANOVA: p=0.18

p<0.01

p<0.01


Slide42 l.jpg

ADH Cluster of aversive memories (n = 90)

GABAA Cluster

Long et al, 1998


Gabra2 ld and alcoholism linkages l.jpg
GABRA2 LD and Alcoholism Linkages of aversive memories (n = 90)

*

*

*

Edenberg et al

Same alleles,

Same haplotype

*

*

*

Kranzler et al

*

*

*

Enoch et al

Haplotype

Tagging

1121121

2212212

2212211


Addictions array for 130 candidate genes l.jpg
Addictions Array for of aversive memories (n = 90)130 Candidate Genes

  • 1536 SNPs

  • Tagging of haplotypes > 0.6% in frequency

  • Avg of >11 SNPs/gene, Range 4 - 35

  • 186 “perfect” genomic control SNPs (AIMs)

    • Balanced set with cross-population D>0.7, and >10x

  • $ <0.05/genotype

  • 25,000 individuals genotyped (Yale, Rockefeller, Wash U, Columbia [2], Univ. Colorado, Emory, VCU, NICHD)


Slide45 l.jpg

Addictions Array of aversive memories (n = 90)

130 Genes

Tagged with

1350 SNPs

Adrenergic

HPA &

Stress

Metabolic

Other

Serotonin

ALDH1A

ALDH2

CAT

CYP2E1

ADH1A

ADH1B

ADH1C

ADH4

ADH5

ADH6

ADH7

ADRA1A

ADRA2A

ADRA2B

ADRA2C

ADRB2

ARRB2

SLC6A2

DBH

BDNF

CCK

CCKAR

CCKBR

CLOCK

HCRT

OXT

NR3C1

SLC29A1

TAC1

CART

CRH

CRHBP

CRHR1

CRHR2

GAL

NPY

NPY1R

NPY2R

NPY5R

HTR1A

HTR1B

HTR2A

HTR2C

HTR3A

HTR3B

MAOA

MAOB

SLC6A3

SLC6A4

TPH2

Dopamine

DDC

DRD1

DRD2

DRD3

DRD4

DRD5

SLC18A2

TH

COMT

Signal

Transduction

ADCY7

AVPR1A

AVPR1B

CDK5R1

CREB1

CSNK1E

FEV

FOS

FOSL1

FOSL2

GSK3B

JUN

MAPK1

MAPK3

MPDZ

NGFB

NTRK2

NTSR1

NTSR2

PPP1R1

BPRKCE

Cholinergic

CHRM1

CHRM2

CHRM3

CHRM4

CHRM5

CHRNA4

CHRNB2

GABA

GABRA2

GABRA4

GABRA6

GABRB1

GABRB2

GABRB3

GABRD

GABRG2

GABRG3

SLC6A11

SLCSA13

GAD1

GAD2

VIAAT

DBI

Opioid

OPRM1

OPRD1

OPRK1

OPRL1

PDYN

PENK

PNOC

POMC

NMDA

Glycine

Cannabinoid

GRIK1

GRIN1

GRIN2A

GRIN2B

GRM1

GLRA1

GLRA2

GLRB

GPHN

CNR1

FAAH


Slide46 l.jpg

Assignment of ancestry with 186 Ancestry-informative SNPs of aversive memories (n = 90)

(Structure2, Four-factor solution)

African

American

Finns

Plains Indians

Han Chinese

0.98

0.01

0.01

0.00

0.05

0.92

0.02

0.00

0.01

0.01

0.98

0.00

0.11

0.02

0.02

0.85


Slide47 l.jpg

Ethnic factor scores of 1051 individuals in 52 CEPH populations

with 186 AIMs

7-factor solution, Structure 2

Africa

Middle

East

Asia

Oceania

Europe

America

Hodgkinson et al, unpublished


Slide48 l.jpg

Repeats in the 5 Kb region upstream of 5-HTT in populations

Macaca mulatta and Homo sapiens

Macaque

Sequence

Identity

20-22 bp

Imperfect

repeats

Human


Slide49 l.jpg

rh-HTTLPR has GxE populations

effects on alcohol

preference &

stress response

Arch Gen Psych 61: 1146, 2004

Biol Psych 55: 733, 2004

ll

ls

ll

ls

Alcohol preference

Peer-

reared

Mother-

reared


Slide50 l.jpg

Serotonin Transporter Genetic Variation and the Response of the

Human Amygdala

Science 2002 July 19; 297(5580):400-3

Ahmad R. Hariri,1 Venkata S. Mattay,1 Alessandro Tessitore,1 Bhaskar Kolachana,1 Francesco Fera,1 David Goldman,2

Michael F. Egan,1 Daniel R. Weinberger1*

1 Clinical Brain Disorders Branch, NIMH, NIH.2 Laboratory of Neurogenetics, NIAAA, NIH.


Slide51 l.jpg

LL the

Sx


Slide52 l.jpg
A common, functional NPY haplotype the influencing anxiety and stress response(Zhifeng Zhou et al, submitted)

  • The common haplotype predicts reduced brain and lymphoblast mRNA levels and plasma NPY

  • The reduction of function haplotype predicts:

    • Trait anxiety

    • Reduced amygdala emotional fMRI activation

    • Reduced amygdala pain/stress induced opioid release

  • A functional promoter locus was identified via in vitro reporter constructs


Slide53 l.jpg

A functional human GCH1 haplotype predicts the

post-diskectomy clinical pain and experimental pain

162

post-diskectomy

patients

547

normal

controls

Tegeder et al, Nature Medicine, 2006


Slide54 l.jpg

Pain-enhanced GCH1 expression the

in the Dorsal Root Ganglion

GCH1 mRNA and protein in rat DRG

are upregulated by nerve injury

Tegeder et al, Nature Medicine, 2006


Slide55 l.jpg

Biopterin synthesis in rat DRG the

is upregulated by nerve injury and blocked by a GCH1 inhibitor

Tegeder et al, Nature Medicine, 2006


Slide56 l.jpg

Rapid inhibition of pain and DRG neuronal activation the

by the GTP cyclohydrolase inhibitor,

2,4-diamino-6-hydroxypyrimidine (DAHP)

Tegeder et al, Nature Medicine, 2006


Slide57 l.jpg

Genotype-predicted NPY expression predicts pain/stress the

induced opioid activation

Zhou et al, submitted


Slide58 l.jpg

2.5 the

Amygdala

Hippocampus

2

1.5

1

0.5

0

Genotype-predicted NPY expression predicts

emotion-induced fMRI activation

Zhou et al, submitted

T Value

Activation (Arbitrary Units)

P

P

= 0.003

= 0.003

Amygdala

P

= 0.006

LL

LL

LH

HH

fMRI

(n = 11)

(n = 42)

(n = 18)

NPY

Diplotype

Hippocampus



Slide60 l.jpg

Functional Allele to Complex Behavior the

GCH1

GABRA2

NPY

BDNF

Val66Met

COMT

Val158Met

Environmental

Factors

HTT

HTTLPR

Episodic

Memory

Executive

Cognition

Anxiety,

Resiliency

Trauma

OCD

Schizophrenia

Alcoholism

Pain

Marker phenotype


Httlpr and anxiety sen burmeister and ghosh 2004 l.jpg
HTTLPR and anxiety the [Sen, Burmeister and Ghosh, 2004]

  • 26 Studies, 5,629 subjects

  • p = 0.087

  • Substantial effect of inventory and inter-study heterogeneity

  • p < 0.000016, NEO, corrected for heterogeneity

  • 0.1 SD increment in TPQ Harm avoidance or NEO Neuroticism per ”s” allele


Triallelic functionality at httlpr l.jpg
Triallelic Functionality at HTTLPR the

  • S and LG are equivalent in expression in lymphoblasts and raphe-derived neurons

  • AP2 transcription factor binds to LG and acts as a repressor of transcription

    • Gel-shift and supershift assays

    • Allele-specific, AP2-specific decoy DNA eliminates the LA:LG difference

Hu et al, AJHG, 2006


Ile425val l.jpg

HTT the

Ile425Val

Ozaki et al, Mol Psych, 2003


Slide64 l.jpg

Replication of HTTLPR-OCD linkage in the

Parent/child trios

Collaboration with James Kennedy, Clarke Centre, Toronto

S

LG

LA

S, LG

LA

Transmitted

27

11

48

20

41

Untransmitted

44

16

26

41

20

Triallelic

Low/High

p = 0.023

p = 0.010

Hu et al, AJHG, 2006


Slide65 l.jpg

HTTLPR genotype and allele frequencies in 169 OCD patients and 253 controls

Genotypes Alleles

SS SLA SLG LALA LALG LGLG S LA LG

OCD 0.21 0.34 0.03 0.34 0.07 0.01 0.38 0.56 0.06

Control 0.16 0.47 0.08 0.19 0.08 0.02 0.44 0.47 0.10

c 2 = 19.4 c 2 =6.6

p = 0.001 p = 0.036

SS SL LL S L

OCD 0.21 0.37 0.42 0.39 0.61

Control 0.16 0.55 0.29 0.44 0.56

c 2 = 15.0c2 = 1.5

p = 0.001 p = 0.216


Slide66 l.jpg

35 and 253 controls

30

25

20

15

10

5

0

100

200

300

400

500

600

Non-additive interaction of MAOA-LPR and testosterone predicts antisocial behavior

ASPD + AUD

AUD, no ASPD

no AUD, no ASPD

Low activity MAOA-LPR

High activity MAOA-LPR

35

30

25

20

Brown/Goodwin

Lifetime Aggression

15

10

5

0

100

200

300

400

500

600

Testosterone (pg/mL)

ba (SE) = 3.49 (1.01); p=0.001

ba (SE) = -0.94 (1.04); p=0.37

Sjoberg et al., Neuropsychopharmacology 2007


ad