Computing patterns in biology
Download
1 / 56

Computing Patterns in Biology - PowerPoint PPT Presentation


  • 450 Views
  • Uploaded on

Systems biology - figure out circuits. of regulation, predict outcome ... Very simple to find these patterns - can even use the

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Computing Patterns in Biology' - Kelvin_Ajay


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Computing patterns in biology l.jpg

Computing Patterns in Biology

Stuart M. Brown

New York University School of Medicine


Why compute biological patterns l.jpg
Why Compute Biological Patterns?

  • Because we can

    • (computer scientists love to find “interesting” problems)

    • patterns are beautiful

  • Its practical - helps with genecloning experiments, predict functions of new proteins

  • Systems biology - figure out circuits of regulation, predict outcome of changes, design new biological systems


  • Overview l.jpg
    Overview

    • Restriction sites

    • Finding genes in DNA sequences

    • Regulatory sites in DNA

    • Protein signals (transport and processing)

    • Protein functional Motifs

    • Protein families

    • Protein 3-D structure


    Restriction sites l.jpg
    Restriction Sites

    • Bacteria make restriction enzymes that cut DNA at specific sequences (4-8 base patterns)

    • Very simple to find these patterns - can even use the “Find” function of your web browser or word processor

    • Open any page of text and look for “CAT”

      • you now have a restriction site search program!


    Nebcutter2 l.jpg
    NEBcutter2

    http://tools.neb.com/NEBcutter2/


    Finding genes in genomic dna l.jpg

    Translate (in all 6 reading frames) and look for similarity to known protein sequences

    Look for long Open Reading Frames (ORFs) between start and stop codons (start=ATG, stop=TAA, TAG, TGA)

    Look for known gene markers

    TAATAA box, intron splice sites, etc.

    Statistical methods (codon preference)

    Finding Genes in Genomic DNA


    Slide7 l.jpg

    GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCATGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT


    Intron exon structure l.jpg
    Intron/Exon structureGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Gene finding programs work well in bacteria

    • None of the gene prediction programs do an adequate job predicting intron/exon boundaries

    • The only reasonable gene models are based on alignment of cDNAs to genome sequence

    • Perhaps 50% of all human genes still do not have a correct coding sequence defined

      (transcription start, intron splice sites)


    Gene finding on the web l.jpg

    GRAIL:GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT Oak Ridge Natl. Lab, Oak Ridge, TN

    http://compbio.ornl.gov/grailexp

    ORFfinder: NCBI

    http://www.ncbi.nlm.nih.gov/gorf/gorf.html

    DNA translation:Univ. of Minnesota Med. School

    http://alces.med.umn.edu/webtrans.html

    GenLang

    http://cbil.humgen.upenn.edu/~sdong/genlang.html

    BCM GeneFinder:Baylor College of Medicine, Houston, TX

    http://dot.imgen.bcm.tmc.edu:9331/seq-search/gene-search.html

    http://dot.imgen.bcm.tmc.edu:9331/gene-finder/gf.html

    Gene Finding on the Web


    Genomic sequence l.jpg
    Genomic SequenceGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Once each gene is located on the chromosome, it becomes possible to get upstream genomic sequence

    • This is where transcription factor (TF) binding sites are located

      • promoters and enhancers

    • Search for known TF sites, and discover new ones (among co-regulated genes)


    Slide11 l.jpg

    Phage CRO repressor bound to DNAGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    Andrew Coulson & Roger Sayles with RasMol, Univ. of Edinburgh 1993


    Many dna regulatory sequences are known l.jpg

    Databases of promoters, enhancers, etc.GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    TransFacthe Transcription Factor database

    4342 entries w/ known protein binding and transcriptional regulatory functions

    Maintained by Gesellschaft for Biotechnologische Forschung mbH (Braunschweig, Germany)

    The Eukaryotic Promoter Database (EPD)

    Bucher & Trifonov. (1986) NAR 14: 10009-26

    1314 entries taken directly from scientific literature

    Maintained by ISREC (Lausanne, Switzerland) as a subset of the EMBL

    Many DNA Regulatory Sequences are Known


    Tf binding sites lack information l.jpg
    TF Binding sites lack informationGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Most TF binding sites are determined by just a few base pairs (typically 6)

    • Sequence is variable (consensus)

    • This is not enough information for proteins to locate unique promoters for each gene

    • TF's bind cooperatively and combinatorially

      • the key is in the location in relation to each other and to the transcription units of genes

    • Can use information from alignment of related genes


    Sequence logos l.jpg
    Sequence LogosGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT


    Tools to find tf sites in dna l.jpg

    GCG: GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCATFINDPATTERNS

    with database file: TFSITES.DAT

    Macintosh (Signal Scan), PC/UNIX (Promoter Scan)

    Dr. Dan S. Prestridge, Univ. of Minnesota

    Tools to find TF sites in DNA


    Websites for promoter finding l.jpg
    Websites for Promoter findingGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    Promoter Scan: NIH Bioinformatics (BIMAS)

    http://bimas.dcrt.nih.gov/molbio/proscan/

    Promoter Scan II: Univ. of Minnesota & Axyx Pharmaceuticals

    http://biosci.cbs.umn.edu/software/proscan/promoterscan.htm

    Signal Scan: NIH Bioinformatics (BIMAS)

    http://bimas.dcrt.nih.gov:80/molbio/signal/index.html

    Transcription Element Search (TESS): Center for Bioinformatics, Univ. of Pennsylvania

    http://www.cbil.upenn.edu/tess/

    Search TransFac at GBF with MatInspector, PatSearch, and FunSiteP

    http://transfac.gbf-braunschweig.de/TRANSFAC/programs.html

    TargetFinder: Telethon Inst.of Genetics and Medicine, Milan, Italy

    http://hercules.tigem.it/TargetFinder.html


    Protein sequence l.jpg
    Protein SequenceGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT


    Protein sequence analysis l.jpg

    Molecular properties GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT(pH, mol. wt. isoelectric point, hydrophobicity)

    Motifs (signal peptide, coiled-coil, trans-membrane, etc.)

    Protein Families

    Secondary Structure (helix vs. beta-sheet)

    3-D prediction, Threading

    Protein Sequence Analysis


    Chemical properties of proteins l.jpg

    Proteins are linear polymers of 20 amino acidsGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    Chemical properties of the protein are determined by its amino acids

    Molecular wt., pH, isoelectric point are simple calculations from amino acid composition

    Hydrophobicity is a property of groups of amino acids - best examined as a graph

    Chemical Properties of Proteins


    Hydrophobicity plot l.jpg
    Hydrophobicity PlotGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    P53_HUMAN (P04637) human cellular tumor antigen p53

    Kyte-Doolittle hydrophilicty, window=19


    Web sites for simple protein analysis l.jpg
    Web Sites for Simple Protein AnalysisGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Protein Hydrophobicity Server: Bioinformatics Unit, Weizmann Institute of Science , Israel

      http://bioinformatics.weizmann.ac.il/hydroph/

    • SAPS - statistical analysis of protein sequences: composition, charge, hydrophobic and transmembrane segments, cysteine spacings, repeats and periodicity

      http://www.isrec.isb-sib.ch/software/SAPS_form.html


    Emboss protein analysis toolkit l.jpg
    EMBOSS Protein Analysis ToolkitGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • plotorf:simple open reading frame finder

    • Garnier: predicts 2ndary structure

    • Charge: plot of protein charge

    • Octanol: hydrophobicity plot

    • Pepwindow: hydorpathy plot

    • pepinfo:plotsprotein secondary structure and hydrophobicity in parallel panels

    • tmap: predict transmembrane regions

    • Topo: draws a map of transmembrane protein

    • Pepwheel: shows protein sequence as helical wheel

    • Pepcoil: predicts coiled-coil domains

    • Helixturnhelix: predicts helix-turn-helix domains


    Simple motifs l.jpg

    Common structural motifsGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    Membrane spanning

    Signal peptide

    Coiled coil

    Helix-turn-helix

    Simple Motifs


    Super secondary structure l.jpg

    Common structural motifsGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    Membrane spanning (GCG= TransMem)

    Signal peptide (GCG= SPScan)

    Coiled coil (GCG= CoilScan)

    Helix-turn-helix (GCG = HTHScan)

    “Super-secondary” Structure


    Web servers that predict these structures l.jpg

    Predict Protein server: : EMBL HeidelbergGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    http://www.embl-heidelberg.de/predictprotein/

    SOSUI: Tokyo Univ. of Ag. & Tech., Japan

    http://www.tuat.ac.jp/~mitaku/adv_sosui/submit.html

    TMpred (transmembrane prediction): ISREC (Swiss Institute for Experimental Cancer Research)

    http://www.isrec.isb-sib.ch/software/TMPRED_form.html

    COILS (coiled coil prediction): ISREC

    http://www.isrec.isb-sib.ch/software/COILS_form.html

    SignalP (signal peptides): Tech. Univ. of Denmark

    http://www.cbs.dtu.dk/services/SignalP/

    Web servers that predict these structures


    Protein domains motifs l.jpg
    Protein Domains/MotifsGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Proteins are built out of functional units know as domains (or motifs)

    • These domains have conserved sequences

      • Often much more similar than their respective proteins

      • Exon splicing theory (W. Gilbert)

        • Exons correspond to folding domains which in turn serve as functional units

        • Unrelated proteins may share a single similar exon (i.e.. ATPase or DNA binding function)


    Motifs are built from multiple alignmennts l.jpg
    Motifs are built from GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCATMultiple Alignmennts


    Protein motif databases l.jpg
    Protein Motif DatabasesGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Known protein motifs have been collected in databases

    • Best database is PROSITE

      • The Dictionary of Protein Sites and Patterns

      • maintained by Amos Bairoch, at the Univ. of Geneva, Switzerland

      • contains a comprehensive list of documented protein domains constructed by expert molecular biologists

      • Alignments and patterns built by hand!


    Prosite is based on patterns l.jpg
    PROSITEGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT is based on Patterns

    Each domain is defined by a simple pattern

    • Patterns can have alternate amino acids in each position and defined spaces, but no gaps

    • Pattern searching is by exact matching, so any new variant will not be found (can allow mismatches, but this weakens the algorithm)


    Tools for prosite searches l.jpg
    Tools for GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCATPROSITE searches

    Free Mac program: MacPattern

    • ftp://ftp.ebi.ac.uk/pub/software/mac/macpattern.hqx

      Free PC program (DOS): PATMAT

    • ftp://ncbi.nlm.nih.gov/repository/blocks/patmat.dos

      GCG provides the program MOTIFS

    • Also in virtually all commercial programs: MacVector, OMIGA, LaserGene, etc.


    Websites for prosite searches l.jpg
    Websites for GCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCATPROSITE Searches

    ScanProsite at ExPASy: Univ. of Geneva

    • http://expasy.hcuge.ch/sprot/scnpsit1.html

      Network Protein Sequence Analysis: Institut de Biologie et Chimie des Protéines, Lyon, France

    • http://pbil.ibcp.fr/NPSA/npsa_prosite.html

      PPSRCH:EBI, Cambridge, UK

    • http://www2.ebi.ac.uk/ppsearch/


    Profiles l.jpg
    ProfilesGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Profiles are tables of amino acid frequencies at each position in a motif

    • They are built from multiple alignments

    • PROSITE entries also contain profiles built from an alignment of proteins that match the pattern

    • Profile searching is more sensitive than pattern searching - uses an alignment algorithm, allows gaps


    Emboss profilesearch l.jpg
    EMBOSS ProfileSearchGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • EMBOSS has a set of profile analysis tools.

    • Start with a multiple alignment

      • fuzzpro: protein pattern search

      • preg: regular expression search of a protein sequence

      • prophecy: create a profile

      • profit:scans a database with your profile

      • prophetmakes pairwise alignments between a single sequence and a profile

      • patmatmotifs: scan a query protein with the PROSITE motif database


    Websites for profile searching l.jpg
    Websites for Profile searchingGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • PROSITE ProfileScan: ExPASy, Geneva

      • http://www.isrec.isb-sib.ch/software/PFSCAN_form.html

    • BLOCKS (builds profiles from PROSITE entries and adds all matching sequences in SwissProt): Fred Hutchinson Cancer Research Center, Seattle, Washington, USA

      • http://www.blocks.fhcrc.org/blocks_search.html

    • PRINTS(profiles built from automatic alignments of OWL non-redundant protein databases): http://www.biochem.ucl.ac.uk/cgi-bin/fingerPRINTScan/fps/PathForm.cgi


    More protein motif databases l.jpg
    More Protein Motif DatabasesGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • PFAM(1344 protein familyHMM profiles built by hand):Washington Univ., St. Louis

      • http://pfam.wustl.edu/hmmsearch.shtml

    • ProDom (profiles built from PSI-BLAST automatic multiple alignments of the SwissProt database): INRA, Toulouse, France

      • http://www.toulouse.inra.fr/prodom/doc/blast_form.html

        [This is my favorite protein database - nicely colored results]


    Sample prodom output l.jpg
    Sample ProDom OutputGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT


    Hidden markov models l.jpg
    Hidden Markov ModelsGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Hidden Markov Models (HMMs) are a more sophisticated form of profile analysis.

    • Rather than build a table of amino acid frequencies at each position, they model the transition from one amino acid to the next.

    • Pfam is built with HMMs.

    • EMBOSS HMM tools (HMMER):

      ehmmBuild ehmmCalibrate

      ehmmSearch ehmmPfam

      ehmmAlign ehmmEmit

      ehmmFetch ehmmIndex


    Discovery of new motifs l.jpg
    Discovery of new MotifsGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • All of the tools discussed so far rely on a database of existing domains/motifs

    • How to discover new motifs

      • Start with a set of related proteins

      • Make a multiple alignment

      • Build a pattern or profile

      • You will need access to a fairly powerful UNIX computer to search databases with custom built profiles or HMMs.


    Patterns in unaligned sequences l.jpg
    Patterns in Unaligned SequencesGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Sometimes sequences may share just a small common region

      • transcription factors

  • MEME:San Diego Supercomputing Facility

    http://www.sdsc.edu/MEME/meme/website/meme.html

  • EMBOSSalso includes the MEME program


  • Protein 3 d structure l.jpg
    Protein 3-D StructureGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT


    Self assembly l.jpg

    Proteins self-assemble in solutionGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    All of the information necessary to determine the complex 3-D structure is in the amino acid sequences

    Structure determines function

    - lock & key model of enzyme function

    Know the sequence, know the function?

    Nearly infinite complexity

    Self-assembly


    Structure prediction l.jpg
    Structure predictionGCCACATGTAGATAATTGAAACTGGATCCTCATCCCTCGCCTTGTACAAAAATCAACTCCAGATGGATCTAAGATTTAAATCTAACACCTGAAACCATAAAAATTCTAGGAGATAACACTGGCAAAGCTATTCTAGACATTGGCTTAGGCAAAGAGTTCGTGACCAAGAACCCAAAAGCAAATGCAACAAAAACAAAAATAAATAGGTGGGACCTGATTAAACTGAAAAGCCTCTGCACAGCAAAAGAAATAATCAGCAGAGTAAACAGACAACCCACAGAATGAGAGAAAATATTTGCAAACCATGCATCTGATGACAAAGGACTAATATCCAGAATCTACAAGGAACTCAAACAAATCAGCAAGAAAAAAATAACCCCATCAAAAAGTGGGCAAAGGAATGAATAGACAATTCTCAAAATATACAAATGGCCAATAAACATACGAAAAACTGTTCAACATCACTAATTATCAGGGAAATGCAAATTAAAACCACAATGAGATGCCACCTTACTCCTGCAAGAATGGCCATAATAAAAAAAAATCAAAAAAGAATAAATGTTGGTGTGAATGTGGTGAAAAGAGAACACTTTGACACTGCTGGTGGGAATGGAAACTAGTACAACCACTGTGGAAAACAGTACCGAGATTTCTTAAAGAACTACAAGTAGAACTACCATTTGATCCAGCAATCCCACTACTGGGTATCTACCCAGAGGAAAAGAAGTCATTATTTGAAAAAGACACTTGTACATACATGTTTATAGCAGCACAATTTGCAATTGCAAAGATATGGAACCAGTCTAAATGCCCATCAACCAACAAATGGATAAAGAAAATATGGTATATATACACCATGGAACACTACTCAGCCATAAAAAGGAACAAAATAATGGCAACTCACAGATGGAGTTGGAGACCACTATTCTAAGTGAAATAACTCAGGAATGGAAAACCAAATATTGTATGTTCTCACTTATAAGTGGGAGCTAAGCTATGAGGACAAAAGGCATAAGAATTATACTATGGACTTTGGGGACTCGGGGGAAAGGGTGGGAGGGGGATGAGGGACAAAAGACTACACATTGGGTGCAGTGTACACTGCTGAGGTGATGGGTGCACCAAAATCTCAGAAATTACCACTAAAGAACTTATCCATGTAACTAAAAACCACCTCTACCCAAATAATTTTGAAATAAAAAATAAAAATATTTTAAAAAGAACTCTTTAAAATAAATAATGAAAAGCACCAACAGACTTATGAACAGGCAATAGAAAAAATGAGAAATAGAAAGGAATACAAATAAAAGTACAGAAAAAAAATATGGCAAGTTATTCAACCAAACTGGTAATTTGAAATCCAGATTGAAATAATGCAAAAAAAAGGCAATTTCTGGCACCATGGCAGACCAGGTACCTGGATGATCTGTTGCTGAAAACAACTGAAAATGCTGGTTAAAATATATTAACACATTCTTGAATACAGTCATGGCCAAAGGAAGTCACATGACTAAGCCCACAGTCAAGGAGTGAGAAAGTATTCTCTACCTACCATGAGGCCAGGGCAAGGGTGTGCACTTTTTTTTTTCTTCTGTTCATTGAATACAGTCACTGTGTATTTTACATACTTTCATTTAGTCTTATGACAATCCTATGAAACAAGTACTTTTAAAAAAATTGAGATAACAGTTGCATACCGTGAAATTCATCCATTTAAAGTGAGCAATTCACAGGTGCAGCTAGCTCAGTCAGCAGAGCATAAGACTCTTAAAGTGAACAATTCAGTGCTTTTTAGTATATTCACAGAGTTGTGCAACCATCACCACTATCTAATTGGTCTTAGTCTGTTTGGGCTGCCATAACAAAATACCACAAACTGGATAGCTCATAAACAACAGGCATTTATTGCTCACAGTTCTAGAGGCTGGAAGTGCAAGATTAAGATGCCAGCAGATTCTGTGTCTGCTGAGGGCCTGTTCCTCATAGAAGGTGCCCTCTTGCTGAATTCTCACATGGTGGAAGGGGGAAAACAAGCTTGCATTGCAAAGAGGTGGGCCTCTTTAATCCCAAAGGCCCCACCTCTAAAAGGCCCCACTTCTGAATACCATTACATTGAGAATTAAGTTTCAACATAGGAATTTGGGGGAACACAAATATCCAGACTGTAGCATAATTCCAGAACGGATTCAT

    • Protein Structure prediction is the “Holy Grail” of bioinformatics

    • Since structure = function, then structure prediction should allow protein design, design of inhibitors, etc.

    • Huge amounts of genome data - what are the functions of all of these proteins?


    3 d structure l.jpg

    Cannot be accurately predicted from sequence alone (known as ab initio)

    Levinthal’s paradox: a 100 aa protein has 3200possible backbone configurations - many orders of magnitude beyond the capacity of the fastest computers

    There are perhaps only a few hundred basic structures, but we don’t yet have this vocabulary or the ability to recognize variants on a theme

    3-D Structure


    Secondary structure l.jpg
    Secondary Structure

    • Protein secondary structure takes one of three forms:

      • Alpha helix

      • Beta pleated sheet

      • Turn

    • 2ndary structure is predicted within a small window

    • Many different algorithms, not highly accurate

    • Better predictions from a multiple alignment


    Structure prediction on the web l.jpg

    Secondary Structural Content Prediction (SSCP): EMBL, Heidelberg

    http://www.bork.embl-heidelberg.de/SSCP/sscp_seq.html

    BCM Search Launcher: Protein Secondary Structure Prediction: Baylor College of Medicine

    http://dot.imgen.bcm.tmc.edu:9331/seq-search/struc-predict.html

    PREDATOR: EMBL, Heidelberg

    http://www.embl-heidelberg.de/cgi/predator_serv.pl

    Structure Prediction on the Web



    Threading protein structures l.jpg
    Threading Protein Structures Heidelberg

    Best bet is to compare with similar sequences that have known structures >> Threading

    • Only works for proteins with >25% sequence similarity to a protein with known structure

    • Some websites offer quick approximations

    • Will improve as more 3-D structures are described


    Websites for 3 d structure prediction l.jpg
    Websites for 3-D structure prediction Heidelberg

    UCLA-DOE Protein Fold Recognition

    http://www.doe-mbi.ucla.edu/people/fischer/TEST/getsequence.html

    SwissModel: ExPASy, Univ. of Geneva

    http://www.expasy.ch/swissmod/SWISS-MODEL.html

    CPHmodels: Technical Univ. of Denmark

    http://www.cbs.dtu.dk/services/CPHmodels/


    View known protein structures l.jpg
    View Known Protein Structures Heidelberg

    • GenBank includes a database of protein 3-D structures and a free viewer: Cn3D

    • GenBank database is derived from PDB (Protein Data Base)

      • primary repository of protein structure data

      • determined by X-ray crystallography and/or NMR

      • has its own data format and many free viewers

      • some are very sophisticated - can calculate intermolecular distances


    Slide52 l.jpg
    Cn3D Heidelberg

    • Cn3D is a helper application that allows you to view three dimensional structures from NCBI's Entrez database.

    • Cn3D runs on Windows, MacOS, and Unix/Linux.

    • Cn3D simultaneously displaysstructure, sequence, and alignment, it also allows the user to set display styles for features of interest.

      http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml

    By being tightly coupled to the genomic and literature databases, Cn3D is the ideal program for viewing structures found in the NCBI databases.


    Rasmol l.jpg
    RasMol Heidelberg

    RasMol is the simplest PDB viewer.

    http://www.umass.edu/microbio/rasmol/

    It can work together with a web browser to let you view the structure of any sequence found with Entrez that has a known 3-D structure.


    Swiss pdb viewer l.jpg
    Swiss PDB Viewer Heidelberg


    Summary l.jpg
    Summary Heidelberg

    • Restriction sites are trivial to compute, but very useful

    • Genomic DNA has genes and other information –> transcription factors

    • Proteins have predictable 2ndary structures and functional domains, but generally can’t predict new 3-D structures

    • Can visualize and compare known structures


    ad