The 3R’s in animal use and a prospective in vitro screening tool for identifying potential immunot...
Download
1 / 32

Research Overview - PowerPoint PPT Presentation


  • 293 Views
  • Uploaded on

The 3R’s in animal use and a prospective in vitro screening tool for identifying potential immunotoxicants. Courtney E.W. Sulentic, Ph.D. Department of Pharmacology & Toxicology Boonshoft School of Medicine, Wright State University. Lecture Outline.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Research Overview' - Jeffrey


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Slide1 l.jpg

The 3R’s in animal use and a prospective in vitro screening tool for identifying potential immunotoxicants

Courtney E.W. Sulentic, Ph.D.

Department of Pharmacology & Toxicology

Boonshoft School of Medicine,

Wright State University


Lecture outline l.jpg
Lecture Outline screening tool for identifying potential immunotoxicants

  • Purpose of the Colgate-Palmolive In Vitro Toxicology Lecture and Luncheon

  • The Necessity, Public Perception, and Paradoxes of Animal Research

  • The 3R’s (Refinement, Reduction, Replacement) in Animal Use

  • In Vitro B-cell Line Model

    • molecular mechanisms by which dioxin inhibits B-cell function

    • identify chemicals that directly target and alter B-cell function


Colgate palmolive in vitro lecture and luncheon l.jpg
Colgate-Palmolive screening tool for identifying potential immunotoxicantsIn Vitro Lecture and Luncheon

  • Purpose of the In Vitro Lecture and Luncheon

    • Feature research using in vitro and alternative techniques

      • study basic mechanisms

      • benefit animal welfare by refining, reducing, or replacing animal use

    • Networking opportunity with peers and professionals in academia, industry, and government

    • Potential for mentorship

  • Colgate-Palmolive Grants and Awards

    • Grants for Alternative Research

      • 15 grants (max. of $40,000) awarded since 2006

    • Awards for Student Research Training in Alternative Methods

      • Up to five student training awards per year at $3,500 each; 23 award recipients since 2000

    • Postdoctoral Fellowship Award in In Vitro Toxicology

      • Fellowships of up to $38,000 awarded alternate years; 17 awarded since 1988

    • Traveling Lectureship in Alternative Methods in Toxicology Award

      • 16 awarded since 1996


Is research with animals necessary l.jpg
Is Research with Animals Necessary? screening tool for identifying potential immunotoxicants

  • Responsible for great advances in biomedical research

  • Most national laws require animal data for safety analysis of new drugs and medical devices

  • SOT Policy Statement:

    • necessary to ensure and enhance human and animal health and protection of the environment

    • in absence of human data, most reliable means of detecting important toxic properties of chemical substances and for estimating risks to human and environmental health

  • Ethical, Emotional, and Political Issue

    • relative value or moral value of humans and animals

      • When needs of animals and humans come into conflict which takes precedence?

      • Wide spectrum of views on this!


Public perception l.jpg
Public Perception screening tool for identifying potential immunotoxicants

  • Animal “rights” versus animals as a resource to be exploited

    • Animal worship by ancient societies

      • recognition of the crucial role of animals in sustaining human life

    • Competition with animals for basic resources

      • species survival and environmental impact

  • Subliminal and overt messages that animal research is wrong

    • Animal rights organizations and websites

      • PETA, Human Seal, StopAnimalTests.Com, etc.

    • Children’s books and movies

      • Nancy Drew: The Teen Model Mystery by Carolyn Keene

      • The Secret of NIMH (National Institute of Mental Health), 1982 animated film based on a Newberry Medal-winning book written by Robert C. O’Brien

    • Celebrities


Public perception6 l.jpg
Public Perception screening tool for identifying potential immunotoxicants

“Today's non-animal research methods are humane, more accurate, less expensive, and less time-consuming than animal experiments, yet change comes slowly and many researchers are unwilling to switch to superior technological advances.

Animal experimentation not only is preventing us from learning more relevant information, it continues to harm and kill animals and people every year. “

-www.stopanimaltests.com

“It is generally accepted within the laboratory animal science community that it is impossible to completely replace the complex physiology and multiple organ systems of live animals with any form of alternatives.“

-Guhad, Contemporary Topics 44:58-59, 2005

www.humanseal.org


The paradox of animal research l.jpg
The Paradox of Animal Research screening tool for identifying potential immunotoxicants

“Ask the experimenters why they experiment on animals, and the answer is: 'Because the animals are like us.'

Ask the experimenters why it is morally OK to experiment on animals, and the answer is: 'Because the animals are not like us.‘

Animal experimentation rests on a logical contradiction."

-Professor Charles R. Magel

Animal rights activists use the same rationale – “Because the animals are like us” – to argue against animal research.


The paradox of animal research8 l.jpg
The Paradox of Animal Research screening tool for identifying potential immunotoxicants

  • appeals to emotion or logic are unlikely to resolve the debate over the use of animals in research

  • tendency to assign roles and labels may profoundly influence ethical decision making

  • results in paradoxes and inconsistencies in the moral status of animals

Herzog, American Psychologist 43:473-474, 1988


Paradox examined the moral status of mice l.jpg
Paradox Examined: The Moral Status of Mice screening tool for identifying potential immunotoxicants

  • The Good Mice: “guinea pig”, test subject

    • existence depends on utility like any other domestic animal

    • entitled to the protection of the U.S. Department of Agriculture (USDA) and oversight of the animal use and care committee

  • The Bad Mice: pest

    • free-ranging animals that are a legitimate contamination threat

    • no protection, must be eliminated

      • poison, snap trap, “sticky trap”

  • The Feeder Mice: food

    • adult, juveniles or newborns fed to carnivorous species (snakes, lizards, large toads) used in research or as pets

    • mammals are covered by the Animal Welfare Act and are deemed worthy of protection by USDA, whereas snakes and other “lower” vertebrates are specifically excluded

  • The Pet Mice

Herzog, American Psychologist 43:473-474, 1988


Animal welfare l.jpg
Animal Welfare screening tool for identifying potential immunotoxicants

“I am not interested to know whether vivisection produces results that are profitable to the human race or doesn’t. … The pain which it inflicts upon unconsenting animals is the basis of my enmity toward it, and it is to me sufficient justification of the enmity without looking further.“

-Mark Twain (1835-1910)

If animal research is necessary as most biomedical and basic scientists and toxicologists would agree it is, then we have an ethicalobligation to assure that we are good stewards of the research animals and that the potential pain and discomfort is as minimal as possible.


Animal welfare11 l.jpg
Animal Welfare screening tool for identifying potential immunotoxicants

“It is universally accepted that good animal welfare contributes to good science, while poor animal welfare can only subtract from good science.

Knowledge of an implementation of the 3R’s can be a proactive response to animal welfare by the primary users of research animals.

Leadership in this area rightly belongs to scientists, animal technicians, veterinarians, and managers of research institutions and less to politicians or militant animal activists.”

-Guhad, Contemporary Topics 44:58-59, 2005


Animal welfare act l.jpg
Animal Welfare Act screening tool for identifying potential immunotoxicants

  • Institutional Animal Care and Use Committee (IACUC)

  • federally mandated at each research institution that uses animals

  • at least five members

    • veterinarian with program responsibilities

    • scientist experienced in laboratory animal research

    • non-scientist

    • individual with no affiliation with the institution

  • authority to suspend research activities

  • evaluates animal use program and facilities

  • reviews and approves all animal use protocols

    • Bad mice (pests) and sticky traps


The 3r s of animal use l.jpg
The 3R’s of Animal Use screening tool for identifying potential immunotoxicants

  • Refinement

    • minimize pain or distress including proper euthanasia

  • Reduction

    • minimize the number of animals

      • good experimental planning that includes pilot studies, maximize information gathered, minimize variables (disease, stress, diet, genetics, etc.), power analysis, literature search to avoid duplication, use of appropriate species

  • Replacement

    • replace with “lower” animals

      • Microorganisms, plants, eggs, reptiles, amphibians, invertebrate

    • replace with non-animal in vitro models and computer modeling

-Russell and Burch, The Principles of Humane Animal Experimental Techniques, 1959


The 3r s of animal use replacement l.jpg
The 3R’s of Animal Use: Replacement screening tool for identifying potential immunotoxicants

  • Replacement

    • Advantage

      • apply known principles to new systems

      • extend mechanistic studies in technically less challenging cellular models

      • Use less expensive “lower” animals or cellular models to screen large numbers of agents for toxicity and mutagenicity

    • Disadvantage

      • models dependent on pre-existing information

      • difficult to incorporate the complexity of living organisms

        • unknown variables in physiology and pathology

        • new biological processes will require validation in living organism


Lecture outline15 l.jpg
Lecture Outline screening tool for identifying potential immunotoxicants

  • Purpose of the Colgate-Palmolive In Vitro Toxicology Lecture and Luncheon

  • The Necessity, Public Perception, and Paradoxes of Animal Research

  • The 3R’s (Refinement, Reduction, Replacement) in Animal Use

  • In Vitro B-cell Line Model

    • molecular mechanisms by which dioxin inhibits B-cell function

    • potential to Identify chemicals that directly target and alter B-cell function


Slide16 l.jpg

O screening tool for identifying potential immunotoxicants

Cl

Cl

1

9

8

2

7

3

4

6

Cl

O

Cl

2,3,7,8-Tetrachlorodibenzo-p-dioxin

(TCDD or dioxin)


Profile of biological activity by tcdd l.jpg
Profile of Biological Activity by TCDD screening tool for identifying potential immunotoxicants

  • enzyme induction (hallmark response)

  • hepatomegaly

  • lymphoid involution: primarily thymus

  • immunomodulation (mostly suppression)

  • chloracne and epithelial hyperplasia

  • teratogenesis (cleft palate)

  • cancer (tumor promoter)

  • wasting syndrome

  • death

Immunity: resistance of an organism to infection, disease, or other unwanted biological invasion


Rationale for focusing on b cells l.jpg
Rationale for Focusing on B cells screening tool for identifying potential immunotoxicants

  • The antibody response has historically been one of the most sensitive indicators of TCDD immunotoxicity.

  • Various studies have identified B cells as a direct and sensitive cellular target of TCDD.

    Immunotoxicology: Evaluating the structure and function of the immune system following exposure to chemicals (environmental agents, pharmaceuticals, substances of abuse, dietary components including herbal remedies and supplements).


B cells effector cells of humoral immunity l.jpg

Proliferation screening tool for identifying potential immunotoxicants

B cells: Effector Cells of Humoral Immunity

TCDD

Resting or naive

Activation

Differentiation


Antibody structure and isotypes l.jpg

µ screening tool for identifying potential immunotoxicants

d

g3

g1

g2b

g2a

e

a

3’IgH RR

VH

VDJ

Em

hs4

hs3a

hs3b

hs1,2

Antibody Structure and Isotypes

Immunoglobulin heavy chain (IgH) gene locus


Slide21 l.jpg

How does TCDD inhibit B cell function? screening tool for identifying potential immunotoxicants


Aryl hydrocarbon signaling pathway l.jpg

c- screening tool for identifying potential immunotoxicantssrc?

AIP

AIP

ARNT

ARNT

ARNT

Aryl Hydrocarbon Signaling Pathway

PCDD

c-src?

PCDF

PCBs

AhR

PBBs

HSP

AhR

HSP

HSP

90

90

90

HSP

90

HSP

AhR

90

Cytosol

HSP

90

HSP

AhR

90

Nucleus

HSP

90

AhR

Cyp1A1

IgH gene too?

AhR

DNA

TNGCGTG

DRE


Hypothesis l.jpg

Mouse screening tool for identifying potential immunotoxicantsIgH locus

µ

d

g3

g1

g2b

g2a

e

a

3’IgH RR

VH

VDJ

Em

hs4

hs3a

hs3b

hs1,2

Hypothesis

  • Inhibition of B-cell function by TCDD is transcriptionally mediated by the AhR which binds DREs within regulatory regions of genes required for Ig expression.

  • In vitro model: CH12.LX B-cell line

    • derived from a mouse B-cell lymphoma

    • extensively utilized to study cellular processes specific to B cells

    • useful model in studying the effects of TCDD on B-cell function

    • validation of results in primary B cells or mouse in vivo models


The ahr arnt heterodimer binds to dre sites within the 3 ighrr l.jpg

ARNT screening tool for identifying potential immunotoxicants

ARNT

The AhR/ARNT heterodimer binds to DRE sites within the 3’IgHRR

µ

d

g3

g1

g2b

g2a

e

a

3’IgH RR

hs4

VH

VDJ

Em

hs3a

hs3b

hs1,2

AhR

hs1,2

TAGGGGTCTATTAACTCACCACGCTAGGCCATCATGGAGAG

DRE

AhR

hs4

AGCAGAGGGGGGGACTGGCGTGGAAAGCCCCATTCACCCAT

DRE


Slide25 l.jpg

The mouse 3’IgHRR is a sensitive transcriptional target of TCDD

unstimulated

LPS stimulated

25

20

15

g2b expression

(ng/2mg total protein)

**

10

**

**

††

5

Cg2b

0

g2b transgene expressed

in the CH12.g2b-3’IgH

in vitro B-cell model

NA

LPS

DMSO

0.1

1.0

10

30

3a

1,2

3b

4

VH

nM TCDD

3’IgHRR


A diverse range of chemicals bind the ahr and inhibit the 3 ighrr l.jpg
A diverse range of chemicals bind the AhR and inhibit the 3’IgHRR

125

IC50

TCDD 5.6x10-10

ICZ 1.1x10-7

Primaquine 2.6x10-5

Omeprazole 3.9x10-5

Carbaryl 4.7x10-5

100

75

g2b IgH protein (% effect)

50

25

0

VH

10

-11

10

-9

10

-7

10

-5

10

-3

NA

Molar Concentration


Slide27 l.jpg

Inhibition of the 3’IgHRR correlates with inhibition of endogenous IgA

unstimulated

LPS stimulated

100

75

**

**

**

††

IgA protein expression

(ng/2mg total protein)

**

50

**

25

0

DMSO

(0.1%)

NA

LPS

DMSO

(0.01%)

TCDD

ICZ

PMQ

CBRL

OME


Slide28 l.jpg

unstimulated endogenous IgA

LPS stimulated

Chemicals other than AhR activators modulate 3’IgHRR activity

**

**

350

300

250

200

g2b expression

(% effect relative to LPS)

150

100

50

0

NA

LPS

20

30

40

50

10

mM H2O2

**

150

350

300

*

250

100

200

g2b expression

(% effect relative to LPS)

g2b expression

(% effect relative to LPS)

150

**

Cg2b

50

100

3a

1,2

3b

4

VH

50

††

0

0

3’IgHRR

NA

LPS

0.5

2.75

5.0

DMSO

NA

LPS

0.1

1.0

10

100

mM BITC

mM Terbutaline


Slide29 l.jpg

Effects on the 3’IgHRR correlate with effects of endogenous IgA

unstimulated

LPS stimulated

200

*

150

IgA protein expression

(% effect relative to LPS)

100

*

*

50

††

††

0

NA

LPS

DMSO

(0.01%)

TCDD

CBOL

TERB

NA

LPS

NA

LPS

DMSO

(0.05%)

BITC

H2O2


Slide30 l.jpg

Summary endogenous IgA

  • Chemical-induced effects on 3’IgHRR activity mirror the effects on endogenous IgH expression and antibody-mediated function.

  • Ourin vitro B-cell line model will provide a useful tool in understanding the mechanisms of altered IgH transcriptional regulation by chemicals.

  • With further validation our model may be useful in identifying potential immunotoxicants that directly target and alter B-cell function.

  • A diverse range of chemicals from environmental, dietary, and pharmaceutical origin have the potential to modulate 3’IgHRR activity which may have significant human health and clinical implications.


Human diseases associated with the 3 ighrr l.jpg
Human Diseases Associated with the 3’IgHRR endogenous IgA

  • Burkitt’s lymphoma

    • Chromosomal translocation between the c-myc locus (chr. 8) and the Ig loci (chr. 2, 14, or 22).

      • Most common is chromosome 8 to 14 translocation which links the c-myc proto-oncogene to the IgH gene and to the 3’IgH RR.

  • IgA nephropathy

    • Most common cause of renal failure.

    • Severity and rapid evolution to renal failure associated with a polymorphic hs1,2 enhancer.

      • Increased number of tandem repeats containing a kB and DRE with a high degree of similarity to the mouse hs1,2 kB and DRE.

  • Celiac disease

    • Fairly common disease of the small intestine.

    • Occurrence associated with polymorphic hs1,2 enhancer.

  • Systemic sclerosis, plaque psoriasis, psoriatic arthritis, dermatitis herpetiformis


Acknowledgements l.jpg
Acknowledgements endogenous IgA

My Mentors

Norbert Kaminski

(Michigan State University)

Sulentic Lab

Eric Romer

DiliniRanatunga

Rebecca Henseler

Rick Salisbury (#1289)

TharuFernando

(#249)

Dave Ellis

(#248)

Roger Fecher

Ruth Chambers-

Turner

Mike Wourms

Sharon Ochs

Geoffrey Haughton

(University of North Carolina)

Laurel Eckhardt

(Hunter College of CUNY)

Leonard Bjeldanes

(University of California Berkeley)

Sanjay Srivastava

(Texas Tech University)

Thomas Brown

(Wright State University)

Michael Denison

(University of California Davis)

Society of Toxicology

In Vitro and Alternative Methods Specialty Section

Support by

Colgate-Palmolive Grant

NIEHS RO1ES014676

WSU

Boonshoft School of Medicine

Research Challenge Grant


ad