18s rrna clone library of phytoplankton in the columbia river and its coastal zone
Download
1 / 21

18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone - PowerPoint PPT Presentation


  • 515 Views
  • Uploaded on

18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone. http://www.mapwatch.com/news-blog/images/phytoplankton.jpg. By Pete Kahn Mentors: Lydie Herfort and Peter Zuber. Significance of phytoplankton. Major primary producers: O 2 : 90%

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone' - Gideon


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
18s rrna clone library of phytoplankton in the columbia river and its coastal zone l.jpg

18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone

http://www.mapwatch.com/news-blog/images/phytoplankton.jpg

By Pete Kahn

Mentors: Lydie Herfort and

Peter Zuber


Significance of phytoplankton l.jpg
Significance of phytoplankton River and its coastal zone

  • Major primary producers:

    O2: 90%

    CO2=>C3: 50%

  • Most abundant eukaryotes: 102 to 104 cells/ mL

  • Base of aquatic food chain


Interactions with other domains l.jpg
Interactions with other Domains River and its coastal zone

http://www.fossilmuseum.net/Tree_of_Life/Domains_Archaea_Bacteria/Domains_of_life.jpg

BacterioplanktonColonization :

POC=>DOC

“Competition” for NO32- and NH3?

  • Grossart, H. P., Czub, G. & Simon,M. (2006). Algae-bacteria interactions and their effects on aggregation and organic matter flux in the sea. Environmental Microbiology8, 1074-1084.


Traditional methods l.jpg
Traditional Methods River and its coastal zone

Flow cytometry

Microscopy: Pediastrium

  • Microscopy

  • Flow Cytometry

  • Pigment analysis:

    Chl a

  • Photosynthesis:

    O2 production

    C14 uptake

http://upload.wikimedia.org/wikipedia/commons/c/c7/Picoplancton_cytometrie.jpg

http://www.keweenawalgae.mtu.edu/ALGAL_IMAGES/chlorophyceans/Pediastrium_n16_dollartow3_402_c.jpg

Filtering for chlorophyll a


Molecular methods for eukaryotes l.jpg
Molecular Methods for eukaryotes River and its coastal zone

  • Pitfalls of Traditional methods: -Microscopy: focus on numerous, “big” organisms; time consuming -Incomplete understanding of diversity

  • Molecular Methods: nucleic acid extraction, PCR, cloning, sequencing

  • Pitfalls of Molecular Methods: biases in PCR primers & preferential amplification of some organisms, i.e. dinoflagellates vs diatoms

Savin, M. C., Martin, J. L., LeGresley, M., Giewat, M. & Rooney-Varga, J. (2004). Plankton diversity in the Bay of Fundy as measured by

morphological andmolecular methods. Microbial Ecology 48, 51-65.


Problems for phytoplankton l.jpg
Problems for phytoplankton River and its coastal zone

  • Traditional methods studies >>>> molecular methods studies

  • Prokaryotic molecular studies >>>> phytoplankton molecular studies


The sampling plan l.jpg
The sampling plan River and its coastal zone

  • 18S rRNA clone library for:

    April: Wecoma & Forerunner: salinity gradient

    Wecoma (CR4s, CR15s, CR30s, CR40s):

    20-32 psu; coastal surface samples

    Forerunner (St 1-5): estuary samples

    0-20 psu, inc. of 5

    June & July: Forerunner: 0 psu & 30 psu from estuary


Sample dates locations l.jpg
Sample Dates & Locations River and its coastal zone

Wecoma April 2007

Forerunner April 2007

Forerunner June 2007

Forerunner July 2007


Goals within cmop l.jpg
Goals within CMOP River and its coastal zone

  • Short term:

    -Good clone library of phytoplankton

    -Determining good primers for isolating 18S rRNA

  • Long term:

    -Understand changes in populations between seasons and locations

    -Better understand unexpected changes in

    community: monitor ecosystem health

    -Bacteria & Archaea relationships/ interactions (Dan Murphy)

    -Better understanding of microbial ecosystem as

    a whole


What we know about columbia river phytoplankton l.jpg
What we know about Columbia River phytoplankton River and its coastal zone

  • Anderson GC. 1972. Aspects of marine phytoplankon studies near the Columbia River with special reference to subsurface chlorophyll maximum. The Columbia River estuary and adjacent ocean waters, University of Washington Press, Seattle, WA, p. 219-240.

  • Contaminant ecology of fish and wildlife of the lower columbia river-final report. April 1996. Lower Columbia River Bi-State Program.

  • Frey BE, R Lara-Lara, LF Small. 1984. Primary production in the Columbia River Estuary water column. Columbia River Estuary Data Development Program.


What we know about columbia river phytoplankton11 l.jpg
What we know about Columbia River phytoplankton River and its coastal zone

Asterionella formosa: most abundant diatom

  • Estuary: >50 species of diatoms; Asterionella formosa; Asterionella kariana; Skeletonema Costatum; Thallasiosira; Stephanodiscus hatzschii

  • Coastal: Chaetoceros convolutus; Dactyliosolen mediterraneus; Thalassionema nitzschioides

http://www.serc.si.edu/labs/phytoplankton/guide/diatoms/images/Asterionella/Asterionella-formosa-PA.jpg

Thalassionema nitzschioides

http://thalassa.gso.uri.edu/flora/imagesfl/tnema1.jpg


Variations in nucleic acid in environmental samples l.jpg
Variations in nucleic acid in environmental samples River and its coastal zone

Oct 2006

Feb 2007

  • Between seasons

  • Between locations

    April Wecoma & Forerunner: Freshwater << Surface Coastal

DNA

RNA


Methods overview l.jpg
Methods Overview River and its coastal zone

Water sample => Sterivex on site

Total nucleic acid extraction from sterivex in lab

DNA removal?

Amplification through PCR

TOPO cloning/ transformation

96 well plates?

Plasmid isolation (Miniprep)

Water samples pass through sterivex filter

Sequences

BLAST=> Clone library


Extraction dna removal l.jpg
Extraction/ DNA removal River and its coastal zone

  • Extraction with LETS buffer + Phenol Chloroform

  • DNA removal with TURBO DNA free kit or Ribopure kit

DNA removed

DNA not removed

Gel after extraction & DNA removal

Sterivex


Slide15 l.jpg
PCR River and its coastal zone

  • Primers: Euk A: AACCTGGTTGATCCTGCC Euk B: TGATCCTTCTGCAGGTTCACCTAC Specific for eukaryotes, Examined with BLAST: highly conserved

  • PCR cleanup with MO-BIO ultra clean kit

Gel after PCR

Diez, B., Pedros-Alio, C. & Massana, R. (2001). Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing. Applied and Environmental Microbiology67, 2932-2941.


Cloning transformation l.jpg
Cloning/ Transformation River and its coastal zone

  • TOPO TA Cloning Kit

  • Transformation with Top 10 chemical competent cells => E. coli

  • Plated onto LB XGAL-AMP plates

    -Selective: cells gain ampicillin resistance from

    plasmid

    -Differential: cells w/plasmid insert turn white

    cells w/ no insert turn blue


Plasmid isolation miniprep l.jpg
Plasmid isolation (miniprep) River and its coastal zone

  • For 96 well plate, no miniprep. Send to Washington University

  • Recover plasmid from E. coli host

  • Clean plasmid and prepare to concentration of 100 ng/ ul

  • Take to primate center for sequencing

Gel from miniprep


Sequences from april l.jpg

St 1 (0 psu): River and its coastal zoneRhizophydium

St 4 (15 psu): Pseudopedinella elastica; Protperidinium leonis; Katablepharis japonica

CR4s (27 psu): Asterionella kariana*; Thalassiosira aestivalis*

Pirsonia guinardiae

Gyrodinium rubrum

CR 15s (20 psu): Thalassiosira pseudonana*:

Sequences from April

Diatom: 1st to have genome sequenced

Dinoflagellate

Fungus

http://genome.jgi-psf.org/Thaps3/Thaps3.home.html

http://www.bsu.edu/classes/ruch/msa/barr/4-1.jpg

http://www4.fimr.fi/project/algaline/GALLERY/0709NBP.JPG


Sequences from station 1 0 psu june l.jpg
Sequences from Station 1 (0 psu) June River and its coastal zone

  • Skeletonema costatum*

    -Diatom; extremely abundant in temperate areas

  • Aulacoseira ambigua

    -river diatom

  • Stephanodiscus hantzschii*

    -eutrophic freshwater diatom

  • Cyclotella meneghiniana

    -river diatom; areas of high conductivity

http://thalassa.gso.uri.edu/ESphyto/list/taxa/skel/skelcos.htm

http://craticula.ncl.ac.uk/Eddi/jsp/taxon.jsp?TaxonId=AU002A

http://www.lancs.ac.uk/staff/kingl/telford/stephhant.htm

http://craticula.ncl.ac.uk/EADiatomKey/html/taxon11.html


Next step l.jpg
Next step River and its coastal zone

  • Use multiple primer sets to decrease PCR biases

  • Traditional methods: Chl a analysis; Flow cytometry; Primary productivity rates

  • Apply protocol to ETM on future cruises


Acknowledgements l.jpg
Acknowledgements River and its coastal zone

  • Lydie and Peter

  • Michiko Nakano

  • Dan Murphy

  • Everyone in Peter & Michiko’s labs

  • Michael Wilkin & the crew of the Forerunner

  • Antonio Baptista

  • NSF

  • All of you


ad