18s rrna clone library of phytoplankton in the columbia river and its coastal zone
Download
Skip this Video
Download Presentation
18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone

Loading in 2 Seconds...

play fullscreen
1 / 21

18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone - PowerPoint PPT Presentation


  • 518 Views
  • Uploaded on

18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone. http://www.mapwatch.com/news-blog/images/phytoplankton.jpg. By Pete Kahn Mentors: Lydie Herfort and Peter Zuber. Significance of phytoplankton. Major primary producers: O 2 : 90%

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about '18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone' - Gideon


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
18s rrna clone library of phytoplankton in the columbia river and its coastal zone

18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone

http://www.mapwatch.com/news-blog/images/phytoplankton.jpg

By Pete Kahn

Mentors: Lydie Herfort and

Peter Zuber

significance of phytoplankton
Significance of phytoplankton
  • Major primary producers:

O2: 90%

CO2=>C3: 50%

  • Most abundant eukaryotes: 102 to 104 cells/ mL
  • Base of aquatic food chain
interactions with other domains
Interactions with other Domains

http://www.fossilmuseum.net/Tree_of_Life/Domains_Archaea_Bacteria/Domains_of_life.jpg

BacterioplanktonColonization :

POC=>DOC

“Competition” for NO32- and NH3?

  • Grossart, H. P., Czub, G. & Simon,M. (2006). Algae-bacteria interactions and their effects on aggregation and organic matter flux in the sea. Environmental Microbiology8, 1074-1084.
traditional methods
Traditional Methods

Flow cytometry

Microscopy: Pediastrium

  • Microscopy
  • Flow Cytometry
  • Pigment analysis:

Chl a

  • Photosynthesis:

O2 production

C14 uptake

http://upload.wikimedia.org/wikipedia/commons/c/c7/Picoplancton_cytometrie.jpg

http://www.keweenawalgae.mtu.edu/ALGAL_IMAGES/chlorophyceans/Pediastrium_n16_dollartow3_402_c.jpg

Filtering for chlorophyll a

molecular methods for eukaryotes
Molecular Methods for eukaryotes
  • Pitfalls of Traditional methods: -Microscopy: focus on numerous, “big” organisms; time consuming -Incomplete understanding of diversity
  • Molecular Methods: nucleic acid extraction, PCR, cloning, sequencing
  • Pitfalls of Molecular Methods: biases in PCR primers & preferential amplification of some organisms, i.e. dinoflagellates vs diatoms

Savin, M. C., Martin, J. L., LeGresley, M., Giewat, M. & Rooney-Varga, J. (2004). Plankton diversity in the Bay of Fundy as measured by

morphological andmolecular methods. Microbial Ecology 48, 51-65.

problems for phytoplankton
Problems for phytoplankton
  • Traditional methods studies >>>> molecular methods studies
  • Prokaryotic molecular studies >>>> phytoplankton molecular studies
the sampling plan
The sampling plan
  • 18S rRNA clone library for:

April: Wecoma & Forerunner: salinity gradient

Wecoma (CR4s, CR15s, CR30s, CR40s):

20-32 psu; coastal surface samples

Forerunner (St 1-5): estuary samples

0-20 psu, inc. of 5

June & July: Forerunner: 0 psu & 30 psu from estuary

sample dates locations
Sample Dates & Locations

Wecoma April 2007

Forerunner April 2007

Forerunner June 2007

Forerunner July 2007

goals within cmop
Goals within CMOP
  • Short term:

-Good clone library of phytoplankton

-Determining good primers for isolating 18S rRNA

  • Long term:

-Understand changes in populations between seasons and locations

-Better understand unexpected changes in

community: monitor ecosystem health

-Bacteria & Archaea relationships/ interactions (Dan Murphy)

-Better understanding of microbial ecosystem as

a whole

what we know about columbia river phytoplankton
What we know about Columbia River phytoplankton
  • Anderson GC. 1972. Aspects of marine phytoplankon studies near the Columbia River with special reference to subsurface chlorophyll maximum. The Columbia River estuary and adjacent ocean waters, University of Washington Press, Seattle, WA, p. 219-240.
  • Contaminant ecology of fish and wildlife of the lower columbia river-final report. April 1996. Lower Columbia River Bi-State Program.
  • Frey BE, R Lara-Lara, LF Small. 1984. Primary production in the Columbia River Estuary water column. Columbia River Estuary Data Development Program.
what we know about columbia river phytoplankton11
What we know about Columbia River phytoplankton

Asterionella formosa: most abundant diatom

  • Estuary: >50 species of diatoms; Asterionella formosa; Asterionella kariana; Skeletonema Costatum; Thallasiosira; Stephanodiscus hatzschii
  • Coastal: Chaetoceros convolutus; Dactyliosolen mediterraneus; Thalassionema nitzschioides

http://www.serc.si.edu/labs/phytoplankton/guide/diatoms/images/Asterionella/Asterionella-formosa-PA.jpg

Thalassionema nitzschioides

http://thalassa.gso.uri.edu/flora/imagesfl/tnema1.jpg

variations in nucleic acid in environmental samples
Variations in nucleic acid in environmental samples

Oct 2006

Feb 2007

  • Between seasons
  • Between locations

April Wecoma & Forerunner: Freshwater << Surface Coastal

DNA

RNA

methods overview
Methods Overview

Water sample => Sterivex on site

Total nucleic acid extraction from sterivex in lab

DNA removal?

Amplification through PCR

TOPO cloning/ transformation

96 well plates?

Plasmid isolation (Miniprep)

Water samples pass through sterivex filter

Sequences

BLAST=> Clone library

extraction dna removal
Extraction/ DNA removal
  • Extraction with LETS buffer + Phenol Chloroform
  • DNA removal with TURBO DNA free kit or Ribopure kit

DNA removed

DNA not removed

Gel after extraction & DNA removal

Sterivex

slide15
PCR
  • Primers: Euk A: AACCTGGTTGATCCTGCC Euk B: TGATCCTTCTGCAGGTTCACCTAC Specific for eukaryotes, Examined with BLAST: highly conserved
  • PCR cleanup with MO-BIO ultra clean kit

Gel after PCR

Diez, B., Pedros-Alio, C. & Massana, R. (2001). Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing. Applied and Environmental Microbiology67, 2932-2941.

cloning transformation
Cloning/ Transformation
  • TOPO TA Cloning Kit
  • Transformation with Top 10 chemical competent cells => E. coli
  • Plated onto LB XGAL-AMP plates

-Selective: cells gain ampicillin resistance from

plasmid

-Differential: cells w/plasmid insert turn white

cells w/ no insert turn blue

plasmid isolation miniprep
Plasmid isolation (miniprep)
  • For 96 well plate, no miniprep. Send to Washington University
  • Recover plasmid from E. coli host
  • Clean plasmid and prepare to concentration of 100 ng/ ul
  • Take to primate center for sequencing

Gel from miniprep

sequences from april
St 1 (0 psu): Rhizophydium

St 4 (15 psu): Pseudopedinella elastica; Protperidinium leonis; Katablepharis japonica

CR4s (27 psu): Asterionella kariana*; Thalassiosira aestivalis*

Pirsonia guinardiae

Gyrodinium rubrum

CR 15s (20 psu): Thalassiosira pseudonana*:

Sequences from April

Diatom: 1st to have genome sequenced

Dinoflagellate

Fungus

http://genome.jgi-psf.org/Thaps3/Thaps3.home.html

http://www.bsu.edu/classes/ruch/msa/barr/4-1.jpg

http://www4.fimr.fi/project/algaline/GALLERY/0709NBP.JPG

sequences from station 1 0 psu june
Sequences from Station 1 (0 psu) June
  • Skeletonema costatum*

-Diatom; extremely abundant in temperate areas

  • Aulacoseira ambigua

-river diatom

  • Stephanodiscus hantzschii*

-eutrophic freshwater diatom

  • Cyclotella meneghiniana

-river diatom; areas of high conductivity

http://thalassa.gso.uri.edu/ESphyto/list/taxa/skel/skelcos.htm

http://craticula.ncl.ac.uk/Eddi/jsp/taxon.jsp?TaxonId=AU002A

http://www.lancs.ac.uk/staff/kingl/telford/stephhant.htm

http://craticula.ncl.ac.uk/EADiatomKey/html/taxon11.html

next step
Next step
  • Use multiple primer sets to decrease PCR biases
  • Traditional methods: Chl a analysis; Flow cytometry; Primary productivity rates
  • Apply protocol to ETM on future cruises
acknowledgements
Acknowledgements
  • Lydie and Peter
  • Michiko Nakano
  • Dan Murphy
  • Everyone in Peter & Michiko’s labs
  • Michael Wilkin & the crew of the Forerunner
  • Antonio Baptista
  • NSF
  • All of you
ad