Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part I

1. Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part I Jim Bono, PhD Microbiologist US Meat Animal Research Center Clay Center, NE GPVEC July 31st 2008 Clay Center, NE

2. Overview of Parts I and II Part I Biotechnology, GMOs, and Genetic Engineering Molecular Genetics (DNA, RNA, and Proteins) Part II Applied Molecular Genetics DNA extraction Cloning DNA libraries Polymerase Chain Reaction (PCR) DNA sequencing Single Nucleotide Polymorphism (SNP) Microarrays

3. Biotechnology Biotechnology is the application of scientific techniques to modify and improve plants, animals, and microorganisms to enhance their value. Agricultural biotechnology is the area of biotechnology involving applications to agriculture. Agricultural biotechnology has been practiced for a long time, as people have sought to improve agriculturally important organisms by selection and breeding. An example of traditional agricultural biotechnology is the development of disease-resistant wheat varieties by cross-breeding different wheat types until the desired disease resistance was present in a resulting new variety. http://www.ctahr.hawaii.edu/gmo/intro/

4. Genetic Engineering & GMO In the 1970s, advances in the field of molecular biology provided scientists with the ability to readily transfer DNA — the chemical building blocks that specify the characteristics of living organisms - between more distantly related organisms. Today, this technology has reached a stage where scientists can take one or more specific genes from nearly any organism, including plants, animals, bacteria, or viruses, and introduce those genes into another organism. This technology is sometimes called genetic engineering. An organism that has been modified, or transformed, using modern biotechnology techniques of genetic exchange is referred to as a genetically modified organism (“GMO”). Roundup herbicide resistance Insect resistance (Bacillus thuringiensis) Insulin production Enviropig(low phosphorus manure - phytate - phytase) http://www.ctahr.hawaii.edu/gmo/intro/

5. Which bull would be the best sire? Can you tell by their appearance?

6. Which bacteria is pathogenic to humans? Can you tell by their appearance? pathmicro.med.sc.edu www.biology.iupui.edu

7. “Genetic Playbook” http://www.kursus.kvl.dk/shares/vetgen/_Popgen/genetics/10/10/sld003.htm www.petecarroll.com

8. All living organisms have DNA

9. Genome Genome = all genetic material in a cell Eukaryotes Prokaryotes Chromosomes Chromosome Plasmid/s

10. Deoxyribonucleic acid (DNA)

11. Deoxyribonucleic acid (DNA) Nucleotides or bases Adenine - A Cytosine - C Guanine - G Thymine - T

12. Deoxyribonucleic acid (DNA)

13. Deoxyribonucleic acid (DNA) Double Helix Nucleotide or base Major groove Minor groove Phosphate-deoxyribose backbone http://en.wikipedia.org/wiki/DNA

14. DNA Replication Spontaneous mutation Point mutation Insertion Deletion 1 error per 1,000 bacterial replication cycles

15. L0029 L0028 tir cesT eae Gene A gene is a locatable region of genomic sequence, corresponding to a unit of inheritance, which is associated with regulatory regions, transcribed regions and/or other functional sequence regions. A gene is a union of genomic sequences encoding a coherent set of potentially overlapping functional products". A gene is often used to refer to an inheritable trait which is usually accompanied by a phenotype as in ("tall genes" or "bad genes") Historically: “One gene, one Protein”

16. Gene content of various organisms

17. Model Gene Typically, cartoon renderings reflect only the single, “sense” strand, but realize there is always also a complementary strand. TATA (-30) ATG TAA AATAA INTRON 3’ 5’ * * 3’-UT Promoter 5’-UT E I E Coding or Sense strand EXONS (Exons contain protein coding sequence, bacterial genes don’t have introns) * - Transcriptional initiation /termination sites TATA - Promoter element TGA, TAA, TAG - Translational stop codon AATAA - Polyadenylation signal ATG - Translational start codon

18. GGATCGGCTAGCTG……...CTACATAGCTAT Gene Transcription GGAUCGGCUAAGCUAU mRNA Translation Gly-Ser-AlA-………….. Protein Protein Biosynthesis

19. Transcription Making a copy of the gene that can be used for translation Protect the DNA Uracil (U) instead of Thymine (T) RNA polymerase reads the nucleotide sequence of the gene and makes a single stranded messenger RNA (mRNA) http://www.dnai.org/a/index.html

20. Translation Process of making a protein from the mRNA Changing language from nucleotides to amino acids Ribosome is responsible for reading the mRNA and making the protein Translational start – ATG Translational stop – TAA, TGA, TAG 3 nucleotides are called a codon Each codon codes for a specific amino acid – 20 amino acids http://www.dnai.org/a/index.html

21. The Genetic Code DNA Codon mRNA Codon Encoded Amino Acid

22. The Genetic Code Transfer RNA (tRNA) Anti-codon F.W. Nicholas, 1996, Introduction To Veterinary Genetics. Oxford Univ. Press

23. Protein Amino(N)-terminus Carboxyl(C)-terminus DNA synthesized 5’-3’ Protein synthesized amino - carboxyl

24. Eukaryotic Protein Biosynthesis TATA (-30) ATG TAA AATAA 5’ 3’ * * Intron Promoter 5’-UT Exon 1 Exon 2 3’-UT Gene Transcription (In nucleus) * * Exon 1---Exon 2 5’-UT 3’-UT 5’ AAAA 3’ mRNA Translation (@ ribosomes & tRNA) (In cyctoplasm) N-terminus C-terminus Pre-Protein * - Transcriptional initiation /termination sites TATA - Promoter element TAA, TGA, TAG - Translational stop codon AATAA - Polyadenylation signal ATG - Translational start codon

25. Homework Design you own gene Double stranded DNA Promoter element Transcriptional initiation /termination sites Translational start codon Intron Translational stop codon Polyadenylation signal

26. Homework example Met Pro Ile Gly Asn tataagaagatctaggaaaggagagattt ATG CCT ATT GGT AAC atattcttctagatcctttcctctctaaa TAC GGA TAA CCA TTG Asn Val Leu Gly Stop cttggtcataatccc AAT GTG CTT GGT TAA gaagatctaata gaaccagtattaggg TTA CAC GAA CCA ATT cttctagattat agggatgcatccc tccctacgtaggg Legend tataa – Transcriptional initiation signal taggaaaggagagattt – 5’ UTR ATG – Translational start cttggtcataatccc – intron TAA – Translational termination gaagatct – 3’ UTR aataa – polyadenylation signal

27. Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part II Jim Bono, PhD Microbiologist US Meat Animal Research Center Clay Center, NE GPVEC July 31st 2008 Clay Center, NE

28. Overview of Parts I and II Part I Biotechnology, GMOs, and Genetic Engineering Molecular Genetics (DNA, RNA, and Proteins) Part II Applied Molecular Genetics DNA extraction Cloning DNA libraries Polymerase Chain Reaction (PCR) DNA sequencing Single Nucleotide Polymorphism (SNP) Microarrays

29. DNA extraction Important to have clean DNA for further experiments “dirty” prep can have contaminates that inhibit enzymatic processes Agarose gel electrophoresis

30. Cloning http://student.britannica.com/comptons/art-90884/DNA-sequences-can-be-cut-in-two-ways?&articleTypeId=31 http://www.accessexcellence.org/RC/VL/GG/plasmid.php

31. Restriction endonucleases Enzymes that cuts double-stranded DNA following its specific recognition of short nucleotide sequences, known as restriction sites, in the DNA

32. Ligase An enzyme that can link together two DNA strands that have single-strand breaks, i.e. DNA cut with a restriction endonuclease.

33. Cloning http://student.britannica.com/comptons/art-90884/DNA-sequences-can-be-cut-in-two-ways?&articleTypeId=31 http://www.accessexcellence.org/RC/VL/GG/plasmid.php

34. DNA libraries Genomic library:  Contains entire DNA content of an organism Suitable for determining genomic DNA sequence Requires chromosomal DNA isolation cDNA library:  Contains entire protein- encoding DNA content Messenger RNA used as a starting material Messenger RNA reverse transcribed into cDNA Requires mRNA isolation

35. Polymerase Chain Reaction (PCR) PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. DNA cloning for sequencing DNA-based phylogeny functional analysis of genes diagnosis of hereditary diseases identification of genetic fingerprints (used in forensic sciences and paternity testing) detection and diagnosis of infectious diseases. www.mun.ca/biology/scarr/PCR_sketch_3.gif

36. Taq polymerase Chien A, Edgar DB, Trela JM (1976). "Deoxyribonucleic acid polymerase from the extreme thermophile Thermus aquaticus". J. Bact. 174: 1550–1557 en.wikipedia.org In 1989 Science Magazine named Taq polymerase its first "Molecule of the Year". Kary Mullis received the Nobel Prize in 1993, the only one awarded for research performed at a biotechnology company. http://www.yellowstone.net/geysers/thermalfeatures.htm

37. DNA sequencing The process of determining the exact order of the nucleotides/bases (A, T, C, and G) that make up the DNA of an organism. Gene number, exact locations, and functions Gene regulation DNA sequence organization Chromosomal structure and organization Noncoding DNA types, amount, distribution, information content, and functions Coordination of gene expression, protein synthesis, and post-translational events Interaction of proteins in complex molecular machines Predicted vs experimentally determined gene function Evolutionary conservation among organisms Protein conservation (structure and function) Proteomes (total protein content and function) in organisms Correlation of SNPs (single-base DNA variations among individuals) with health and disease Disease-susceptibility prediction based on gene sequence variation Genes involved in complex traits and multigene diseases Complex systems biology including microbial consortia useful for environmental restoration Developmental genetics, genomics

38. New Sequencing technologies Roche FLX 454 100 million bases per chip $6,000 1 week from DNA extraction to sequence data E. coli genome 5.5 million bases – a 454 run will give an 18x coverage Human genome 3 billion base – 30 runs would give a 1X coverage ABI 3730 (384 well plate) 422 thousand bases per plate 9 plates = $6,000 4 million bases 2 weeks from DNA extraction to sequence data

39. Single Nucleotide Polymorphism (SNP) DNA sequence variation occurring when a single nucleotide - A, T, C, or G - in the genome (or other shared sequence) differs between members of a species (or between paired chromosomes in an individual). Not all SNPs cause a phenotypic change 50K SNP chip – interrogates 50,000 SNP Parentage Association of disease traits –FPT Heaton MP, Harhay GP, Bennett GL, Stone RT, Grosse WM, Casas E, Keele JW, Smith TP, Chitko-McKown CG, Laegreid WW. Selection and use of SNP markers for animal identification and paternity analysis in U.S. beef cattle. Mamm Genome. 2002 May;13(5):272-81. Clawson ML, Heaton MP, Chitko-McKown CG, Fox JM, Smith TP, Snelling WM, Keele JW, Laegreid WW. Beta-2-microglobulin haplotypes in U.S. beef cattle and association with failure of passive transfer in newborn calves. Mamm Genome. 2004 Mar;15(3):227-36.

40. KS368 KS546 TX265 TX723 NE972 NE1370 CO50 TX376 Mass2 EDL 931 1271-84 EDL 933 CO147 CO713 IDPH31277 MARC611 NE1124 TW04863 WRRC1 NE1270 Sakai TW05356 3526-87 SNPs in E. coli O157:H7 25 20 15 10 35 30 5 0 bovine 100 bovine 0 Ability to predict those isolates which can cause disease in humans bovine 0 bovine 100 bovine 91 bovine 89 bovine 87 bovine human 100 human 0 human 0 human 0 bovine 0 bovine 0 78 human 0 bovine 0 bovine 0 bovine 0 human 100 bovine 97 human 94 bovine 95 human B. Finlay

41. …aatggtatcTattaatgctt… …aatggtatcAattaatgctt… …aatggtatcAattaatgctt… SNP maternal chromosome maternal chromosome maternal chromosome DNA trace files MALDI-TOF spectra gene …aatggtatcTattaatgctt… …aatggtatcTattaatgctt… …aatggtatcAattaatgctt… paternal chromosome paternal chromosome paternal chromosome individual #1: A T Exon 3 Exon 1 Exon 2 Exon 4 A/A individual #2: A/T A/A T/T individual #3: T/T 5100 5400 5700 SNPs

42. Many different technologies for SNP interrogation Real-time PCR Sequenome Affymetrix Illuminia Biotrove

43. DNA Microarrays A high-throughput technology that consists of an arrayed series of thousands of microscopic spots of DNA oligonucleotides of a specific DNA sequence. This can be a short section of a gene or other DNA element that are used as probes to hybridize DNA or cDNA sample (called target) under high-stringency conditions. Probe-target hybridization is usually detected and quantified by fluorescence-based detection of fluorophore-labeled targets to determine relative abundance of nucleic acid sequences in the target.

44. Perfect- ...ATGCATGCATGCATGC... :::::::::::::::: ...TACGTACGTACGTACG*.. Imperfect- ...ATGCATGGGTGCATGC... ::::::: ::::::: ...TACGTACGTACGTACG*.. G Imperfect- T T G G ...ATGCATG TGCATGC... ::::::: ::::::: ...TACGTACGTACGTACG*.. Hybridization Hybridization is the process of combining complementary, single-stranded nucleic acids into a single molecule. DNA microarrays mRNA expression SNPs Gene content http://www.bio.davidson.edu/Courses/genomics/chip/chip.html

45. Homework Describe PCR in your own words and pictures Describe a potential application for SNP genotyping in veterinary medicine or beef production

46. Websites http://www.dnai.org/ http://dynamicgene.dnalc.org/structure/structure.html http://www.blackwellpublishing.com/trun/artwork/Animations/cloningexp/cloningexp.html