Mbi 2005 workshop in phylogenetics and phylogeography
Download
1 / 37

MBI 2005 Workshop in - PowerPoint PPT Presentation


  • 295 Views
  • Uploaded on

MBI 2005 Workshop in Phylogenetics and Phylogeography. Perspective an empiricist (and bird watcher!) Enthusiastic producer of DNA sequence data unabashed consumer of computational analysis packages Allele frequency approaches to population structure

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'MBI 2005 Workshop in ' - Antony


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Mbi 2005 workshop in phylogenetics and phylogeography l.jpg
MBI 2005 Workshop in Phylogenetics and Phylogeography

  • Perspective

    • an empiricist (and bird watcher!)

      • Enthusiastic producer of DNA sequence data

      • unabashed consumer of computational analysis packages

  • Allele frequency approaches to population structure

    • Analysis of population structure in House Finches using AFLPs

      • Diagnosing populations with large numbers of loci

      • Geographic differentiation: contrast between statistical and biological significance

  • Genealogical approaches to population history

    • Multilocus sequence data sets for Australian birds

      • Little reciprocal monophyly for neutral loci

      • Need for multi-species population genetic models


House finches and mycoplasma a recent host parasite interaction l.jpg
House Finches and Mycoplasma:a recent host-parasite interaction

  • Mycoplasma gallisepticum escaped chickens and invaded House Finches in the eastern U. S., ~1994

  • 9 years later, finches are more resistant to the bacterium and recent strains are attenuated

  • Have finches evolved resistance?

    • AFLP study: What is the geographic setting in which this epizootic took place?


Recent history of house finch populations l.jpg
Recent history of House Finch populations

historic

range

~1870

bottleneck?

1940

~200 birds


Aflp survey of house finches l.jpg

163 individuals, 16 populations

3 primer combinations

166 polymorphic bands

61% polymorphic bands

AFLP survey of House Finches

Cassin’s Finch

Purple Finch

California

Mexico

Wang Z, et al. (2003) Evolution57, 2852-2864.


Slide5 l.jpg

AFLPs: House Finch are moderately structured

with little evidence for genetic bottlenecks

Nucleotide diversity

(estimated number of substitutions per 1000 sites)

Distribution of variation

(AMOVA)

Among individuals w/in pops.

original range

introduced range

10

9

8

7

6

70.7%

5

8.1%

4

3

2

21.2%

1

0

Mex.

Can.

CA

CA

TX

AR

CO

WA

MI

ME

NY

OH

MD

PA

AL

HI

Among pops. w/in subspecies

Among subspecies

Wang Z, et al. (2003) Evolution57, 2852-2864.


Slide6 l.jpg

Tripartite structure of House Finch populations

suggested by assignment test of AFLP data

(program STRUCTURE: J. Pritchard et al. 2000. Genetics 155: 945-959)

Western U.S.

Hawaii

Eastern U. S.

Wang Z, et al. (2003) Evolution57, 2852-2864.


F st with large numbers of loci statistical and biological significance l.jpg
Fst with large numbers of loci: statistical and biological significance

Geogaphic distance (km)

Wang Z, et al. (2003) Evolution57, 2852-2864.


Slide8 l.jpg

Low resolution of population trees using AFLP data

Wang Z, et al. (2003) Evolution57, 2852-2864.


Slide9 l.jpg

Two rules of gene trees near the species boundary

1. Gene trees don’t always match the species tree2. Gene divergence often precedes population divergence

Species tree

Gene tree

2Ne

T/2Ne


Slide10 l.jpg

The need for estimating ancestral population size () when

inferring species divergence time ( or )

present

Time

Time

[generations]

t

[generations x m =

number of mutations]

/2

D

T

past


Slide11 l.jpg

Pincongruence = 2/3e-2  /

“Mismatch Method”

Species vs. Gene Trees

1

2

3

1

3

2

2

3

1

congruent gene tree

incongruent gene tree

incongruent gene tree

Nei 1987. Molecular Evolutionary Genetics

Wu 1991. Genetics 127:429-435

Hudson 1992. Genetics 131:509-512

Yang 2002. Genetics 162:1811-1823

Rannala B, Yang Z. 2003. Genetics 164, 1645-1656.


Slide12 l.jpg

Bayes Markov chain Monte Carlo (MCMC) method

(Yang and Rannala)

  • - multiple independent loci

  • estimates ancestral q (present q also)

  • - estimates population divergence times

  • - uses branch length information

  • - accounts for uncertainty in gene trees

  • Assumptions:

  • “know” the species tree

  • - random mating

  • - no gene flow after population divergence

  • - free recombination among loci (not within)

Yang 2002. Genetics 162:1811-1823

Rannala B, Yang Z. 2003. Genetics 164, 1645-1656


Slide13 l.jpg

1

-

2

k

b

s

h

e

a

r

e

d

f

r

a

g

m

e

n

t

s

1

.

s

o

n

i

c

a

t

i

o

n

2

.

r

e

p

a

i

r

r

a

g

g

e

d

4

.

s

e

q

u

e

n

c

e

e

n

d

s

;

m

a

k

e

b

l

u

n

t

r

a

n

d

o

m

c

l

o

n

e

s

3

.

c

l

o

n

e

b

l

u

n

t

f

r

a

g

m

e

n

t

s

Advantages of SNPs over microsatellites

  • Mutational scale directly comparable to mtDNA

  • Mutational homoplasy is minimal

  • Gene trees easily constructed

  • Diversities easily compared across species

Obtaining anonymous loci

Genomic DNA

1-2 kb insert

pUC 18 vector

Brumfield R. et al. 2003TREE18, 249-256.


Slide14 l.jpg

Ascertainment bias and sampling strategy for SNPs

SNPs

Microsatellites

*

*

*

*

Diversity

Diversity

*

*

*

*

*

*

Locus

1

2

3

4

5

6

7

8

Locus

1

2

3

4

5

6

7

8

Locus chosen for phylogeographic survey

*

study

population

panel

SNP



Slide16 l.jpg

haplotype

inference -

(PHASE)

amplification of

autosomal diploid

products

Test for

recombination

indel

resolution

Pipeline for multilocus data analysis

Demographic

inference

field

sampling


Resolving haplotypes from diploid pcr products l.jpg

AGGCGTTCTTACGACCTTAAGCTCATCCGATAATCTC

haplotype 1

AGGCGTACTTACGACCTTAAGCTCATCGGATAATCTC

haplotype 2

PHASE: Stephens M, Am. J. Hum. Genet. 68, 978-989.

Resolving haplotypes from diploid PCR products

A

C

AGGCGTCTTACGACCTTAAGCTCATCGATAATCTC

diplotype

G

T


Slide18 l.jpg

Resolving heterozygous indels viacloning or allele-specific PCR

Jennings WB, Edwards SV (2005) Evolution in press.



Carpentarian barrier b is deepest split in area cladograms l.jpg
Carpentarian barrier (B) is deepest split in area cladograms

Cracraft J (1986) Evolution 40, 977-996.


Gene tree of western babbler lineage l.jpg
Gene tree of western babbler lineage

Migration event

reconstructed by

parsimony


Assumed phylogeny of poephila finches l.jpg
Assumed phylogeny of Poephila finches

c. atropygialis

acuticauda

hecki

Black-throated Finch

Long-tailed Finch


Characteristics of 30 anonymous loci from poephila finches l.jpg
Characteristics of 30 anonymousloci from Poephila finches

9

7

8

6

7

5

6

4

5

Frequency

Frequency

4

3

3

2

2

1

1

0

0

More

0.4

0.8

1.2

1.6

2.4

2.8

3.2

3.6

0

2

4

100

150

200

250

300

350

400

450

500

550

600

650

700

750

800

More

Percent divergence

Sequence length (bp)

7

6

5

Frequency

4

3

2

1

0

30

33

36

39

42

45

48

51

54

More

% GC content

Jennings WB, Edwards SV (2005) Evolution in press.


30 gene trees from australian finches l.jpg
30 gene trees from Australian finches

Jennings WB, Edwards SV (2005) Evolution in press.



Slide26 l.jpg

prior, analysis 1

prior, analysis 2

posterior, analysis 1

posterior, analysis 2

ML estimate



Slide28 l.jpg

Analysis suggests Pleistocene divergence

across the Carpentarian barrier

“Long-tailed Finch”

“Black-throated Finch”

acuticauda

c. atropygialis

hecki

ha (t) 0.61 MY (0.35 MY - 86 MY)

ha Ne= ~384,000 (240,000-530,000)

hac(t)0.1 MY (0.01 MY - 0.34 MY)

hac Ne= 521,000 (320,000-767,000)

 = 4Ne

 = t

generation time = 1 year

= ~3.6 x 10-9 substitutions/site/year (gamebirds)


Slide29 l.jpg

gene divergence (

D

/ 2)

Gene divergence (D/2)

3.00

population divergence (

) - MLE

g

Population divergence () - MLE

2.80

population divergence (

) - Bayesian

g

Population divergence () - Bayesian

2.60

2.40

2.20

2.00

Pliocene

1.80

Pleistocene

1.60

Divergence Time (MYA)

1.40

1.20

1.00

0.80

0.60

0.40

0.20

0.00

1

cincta

vs.

(acuticauda, hecki)

acuticauda

vs

. hecki


Slide30 l.jpg

Summary of Population Divergence Times

Long-tailed Finch

Black-throated Finch

acuticauda

atropygialis

hecki

Kimberley/

Arnhem Land Barrier

(0.6 MYA)

Carpentarian

Barrier

0.7 MYA

maps from Schodde and Mason 1999. The Directory of Australian Birds: Passerines



Slide32 l.jpg

10 gene trees in Australian treecreepers

Brown Treecreeper (eastern) lineages

Black-tailed (western) Treecreeper lineages

Cape York (far north)

Pilbara (far west)

AL3

AL5

AL7

AL14

AL16

+

+

+

+

+

AL18

AL19

AL20

AL21

AL22

+

+

+

+

+

+


Migrate analysis reveals extensive gene flow and geographic variation in population size l.jpg

Migrate analysis reveals extensive gene flow and geographic variation in population size

Weipa

Douglas Hot Springs

= 0.0102

Fitzroy Crossing

0.0047

+/-0.0014

Forsayth

Doomadgee

Black-tailed

Treecreepers

Longreach

Brown

Treecreepers

Newman

Bourke

Sedan

Rotzel, Edwards and Beerli, unpubl. data


Implications of finch gene trees for selection and the genealogical species concept l.jpg

Implications of finch gene trees for selection and the variation in population sizegenealogical species concept

acuticauda, hecki

cincta

Edwards et al. 2005 PNAS 102, 6550


Alternative models of population history quo vadis l.jpg

Alternative models of population history: variation in population sizequo vadis?

pure isolation model

isolation-migration model

equilibrium migration model


Slide36 l.jpg

Conclusions variation in population size

• As the number of loci grows, distinguishing statistical

from biological significance will be important

• Is haplotype inference really necessary?

• Lack of reciprocal monophyly will be common in vertebrate

sequence data sets


Acknowledgements l.jpg
Acknowledgements variation in population size

  • Australian

  • phylogeography

  • Bryan Jennings

  • Nancy Rotzel

  • Peter Beerli

  • House Finch evolution

  • Geoff Hill

  • Zhenshan Wang

  • Funding

  • NSF


ad